Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
A1BG-AS1
hsa-miR-1-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000594950
Biotype: antisense
Gene id: ENSG00000268895
Gene Name: A1BG-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58354337-58354365
exon
HITS-CLIP
DIRECT
LncBasev2
A1BG-AS1
hsa-miR-1-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000595302
Biotype: antisense
Gene id: ENSG00000268895
Gene Name: A1BG-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58354411-58354439
exon
HITS-CLIP
DIRECT
LncBasev2
A2M-AS1
hsa-miR-1-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000499762
Biotype: antisense
Gene id: ENSG00000245105
Gene Name: A2M-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:9066778-9066806
exon
HITS-CLIP
DIRECT
LncBasev2
A2M-AS1
hsa-miR-1-3p
IP

Gene Details
Chromosome: 12
Transcript: NR_026971.1
Biotype: antisense
Gene id: NR_026971.1 (gene)
Gene Name: A2M-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:9066778-9066806
exon
HITS-CLIP
DIRECT
LncBasev2
AC005062.2
hsa-miR-1-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000418442
Biotype: sense_overlapping
Gene id: ENSG00000243004
Gene Name: AC005062.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:20130938-20130966
exon
HITS-CLIP
DIRECT
LncBasev2
AC006116.27
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000590141
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267459
Gene Name: AC006116.27
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:56377725-56377753
exon
HITS-CLIP
DIRECT
LncBasev2
AC007238.1
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434096
Biotype: processed_pseudogene
Gene id: ENSG00000231043
Gene Name: AC007238.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58460444-58460472
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58460444-58460472
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-1-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39599695-39599723
exon
HITS-CLIP
DIRECT
LncBasev2
AC009120.6
hsa-miR-1-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000621548
Biotype: lincRNA
Gene id: ENSG00000259972
Gene Name: AC009120.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:74306112-74306140
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000555227
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92886635-92886663
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-1-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000555520
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92887973-92888001
exon
HITS-CLIP
DIRECT
LncBasev2
AC074138.3
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000425254
Biotype: lincRNA
Gene id: ENSG00000225975
Gene Name: AC074138.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36685482-36685510
exon
HITS-CLIP
DIRECT
LncBasev2
AC104297.1
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000393779
Biotype: processed_pseudogene
Gene id: ENSG00000213383
Gene Name: AC104297.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:17872491-17872519
exon
HITS-CLIP
DIRECT
LncBasev2
ACAP2-IT1
hsa-miR-1-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000419899
Biotype: sense_intronic
Gene id: ENSG00000229325
Gene Name: ACAP2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195282658-195282686
exon
HITS-CLIP
DIRECT
LncBasev2
AF127936.7
hsa-miR-1-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000432230
Biotype: lincRNA
Gene id: ENSG00000235609
Gene Name: AF127936.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14823924-14823952
exon
HITS-CLIP
DIRECT
LncBasev2
AL590762.6
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000436372
Biotype: processed_pseudogene
Gene id: ENSG00000224208
Gene Name: AL590762.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:71315039-71315067
exon
HITS-CLIP
DIRECT
LncBasev2
ALDH7A1P1
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000510973
Biotype: processed_pseudogene
Gene id: ENSG00000251400
Gene Name: ALDH7A1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:77291613-77291641
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD18DP
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000435620
Biotype: processed_transcript
Gene id: ENSG00000226435
Gene Name: ANKRD18DP
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:198058397-198058425
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD36BP2
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000622311
Biotype: processed_transcript
Gene id: ENSG00000230006
Gene Name: ANKRD36BP2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:88801425-88801453
exon
HITS-CLIP
DIRECT
LncBasev2
BAALC-AS1
hsa-miR-1-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000500902
Biotype: antisense
Gene id: ENSG00000247081
Gene Name: BAALC-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1-3p
Sequence: uggaauguaaagaaguauguau
MirBase ID: MIMAT0000416
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:103165889-103165922
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: