Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-106b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC006548.28
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:16991133-16991161
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159340-30159368
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159340-30159368
exon
HITS-CLIP
DIRECT
LncBasev2
AC007899.3
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000412776
Biotype: processed_pseudogene
Gene id: ENSG00000224891
Gene Name: AC007899.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37148649-37148677
exon
PAR-CLIP
DIRECT
LncBasev2
AC012123.1
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000426194
Biotype: antisense
Gene id: ENSG00000228835
Gene Name: AC012123.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:32773625-32773653
exon
PAR-CLIP
DIRECT
LncBasev2
ADAMTSL4-AS1
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000615012
Biotype: retained_intron
Gene id: ENSG00000203804
Gene Name: ADAMTSL4-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:150560342-150560370
exon
HITS-CLIP
DIRECT
LncBasev2
1:150560342-150560370
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32527425-32527453
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:116108032-116108060
exon
HITS-CLIP
DIRECT
LncBasev2
ATP1B3P1
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000605365
Biotype: processed_pseudogene
Gene id: ENSG00000271707
Gene Name: ATP1B3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:60735119-60735147
exon
HITS-CLIP
DIRECT
LncBasev2
ATP8B5P
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000430846
Biotype: processed_transcript
Gene id: ENSG00000179766
Gene Name: ATP8B5P
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:35449991-35450019
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:7891725-7891753
exon
HITS-CLIP
DIRECT
LncBasev2
BZRAP1-AS1
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000580022
Biotype: antisense
Gene id: ENSG00000265148
Gene Name: BZRAP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:58353252-58353280
exon
PAR-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646193-116646221
exon
HITS-CLIP
DIRECT
LncBasev2
CAP1P2
hsa-miR-106b-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000417455
Biotype: processed_pseudogene
Gene id: ENSG00000232004
Gene Name: CAP1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:43604926-43604954
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:43604926-43604954
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521210-140521238
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140521047-140521075
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521210-140521238
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521210-140521238
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521210-140521238
exon
PAR-CLIP
DIRECT
LncBasev2
8:140528961-140528989
exon
PAR-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140521210-140521238
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: ESC
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29057054-29057082
exon
PAR-CLIP
DIRECT
LncBasev2
CROCCP2
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000412962
Biotype: lincRNA
Gene id: ENSG00000215908
Gene Name: CROCCP2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:16618524-16618552
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494846-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
5:149494871-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494846-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
5:149494871-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494846-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: ESC
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494871-149494899
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57308135-57308163
exon
PAR-CLIP
DIRECT
LncBasev2
19:57308135-57308163
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57308135-57308163
exon
HITS-CLIP
DIRECT
LncBasev2
19:57306646-57306674
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:57306646-57306674
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2013M15.1
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000510987
Biotype: lincRNA
Gene id: ENSG00000250122
Gene Name: CTD-2013M15.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:45895927-45895955
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-2199O4.3
hsa-miR-106b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000566945
Biotype: lincRNA
Gene id: ENSG00000260515
Gene Name: CTD-2199O4.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-106b-5p
Sequence: uaaagugcugacagugcagau
MirBase ID: MIMAT0000680
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:10196562-10196590
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: