Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-124-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002075.3
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000457396
Biotype: processed_pseudogene
Gene id: ENSG00000225898
Gene Name: AC002075.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:93778389-93778417
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-124-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30635061-30635089
exon
HITS-CLIP
DIRECT
LncBasev2
AC005592.3
hsa-miR-124-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000566527
Biotype: lincRNA
Gene id: ENSG00000261757
Gene Name: AC005592.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:142703812-142703840
exon
HITS-CLIP
DIRECT
LncBasev2
AC006042.8
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000454684
Biotype: processed_pseudogene
Gene id: ENSG00000233264
Gene Name: AC006042.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:7980487-7980515
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-124-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000555227
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92886468-92886496
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92886468-92886496
exon
HITS-CLIP
DIRECT
LncBasev2
AC013467.1
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000430717
Biotype: processed_pseudogene
Gene id: ENSG00000227180
Gene Name: AC013467.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: ESC
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:174300014-174300042
exon
PAR-CLIP
DIRECT
LncBasev2
AC018647.3
hsa-miR-124-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000432866
Biotype: lincRNA
Gene id: ENSG00000227544
Gene Name: AC018647.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:35719613-35719641
exon
HITS-CLIP
DIRECT
LncBasev2
AC018647.3
hsa-miR-124-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_108082.1
Biotype: lincRNA
Gene id: NR_108082.1 (gene)
Gene Name: AC018647.3
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:35719613-35719641
exon
HITS-CLIP
DIRECT
LncBasev2
AC073043.1
hsa-miR-124-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000594069
Biotype: lincRNA
Gene id: ENSG00000232732
Gene Name: AC073043.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:199909358-199909386
exon
HITS-CLIP
DIRECT
LncBasev2
AC074117.10
hsa-miR-124-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000447070
Biotype: antisense
Gene id: ENSG00000234072
Gene Name: AC074117.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27357986-27358014
exon
HITS-CLIP
DIRECT
LncBasev2
AC079325.6
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425002
Biotype: unprocessed_pseudogene
Gene id: ENSG00000231027
Gene Name: AC079325.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:74567309-74567337
exon
HITS-CLIP
DIRECT
LncBasev2
AC096772.6
hsa-miR-124-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000343987
Biotype: lincRNA
Gene id: ENSG00000244567
Gene Name: AC096772.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:207822650-207822678
exon
HITS-CLIP
DIRECT
LncBasev2
AF121897.4
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000411867
Biotype: processed_pseudogene
Gene id: ENSG00000235012
Gene Name: AF121897.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:39529238-39529266
exon
HITS-CLIP
DIRECT
LncBasev2
AL022344.7
hsa-miR-124-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000568976
Biotype: lincRNA
Gene id: ENSG00000259869
Gene Name: AL022344.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:42751305-42751333
exon
HITS-CLIP
DIRECT
LncBasev2
AL590762.11
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000391782
Biotype: processed_pseudogene
Gene id: ENSG00000213018
Gene Name: AL590762.11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
X:71420305-71420333
exon
HITS-CLIP
DIRECT
LncBasev2
AP001429.1
hsa-miR-124-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000602568
Biotype: sense_intronic
Gene id: ENSG00000270116
Gene Name: AP001429.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
21:37101184-37101212
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-124-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7881722-7881750
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-124-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646164-116646192
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-124-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96093572-96093600
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-124-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207807031-207807059
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: