Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-125a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AATK-AS1
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000414089
Biotype: antisense
Gene id: ENSG00000225180
Gene Name: AATK-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
17:81166801-81166829
exon
HITS-CLIP
DIRECT
LncBasev2
AC003092.1
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000415536
Biotype: lincRNA
Gene id: ENSG00000236453
Gene Name: AC003092.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:94064614-94064642
exon
HITS-CLIP
DIRECT
LncBasev2
AC004893.11
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000360902
Biotype: antisense
Gene id: ENSG00000242687
Gene Name: AC004893.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:99013410-99013438
exon
HITS-CLIP
DIRECT
LncBasev2
AC008753.3
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000423096
Biotype: processed_pseudogene
Gene id: ENSG00000238150
Gene Name: AC008753.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:53775597-53775625
exon
HITS-CLIP
DIRECT
LncBasev2
AC011625.1
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000455442
Biotype: antisense
Gene id: ENSG00000223436
Gene Name: AC011625.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:132366012-132366040
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201070-176201098
exon
HITS-CLIP
DIRECT
LncBasev2
2:176201226-176201254
exon
HITS-CLIP
DIRECT
LncBasev2
AC090602.2
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000469695
Biotype: processed_pseudogene
Gene id: ENSG00000242088
Gene Name: AC090602.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24911053-24911081
exon
HITS-CLIP
DIRECT
LncBasev2
AC103564.6
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432853
Biotype: unprocessed_pseudogene
Gene id: ENSG00000232760
Gene Name: AC103564.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131836128-131836156
exon
HITS-CLIP
DIRECT
LncBasev2
AP000318.2
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000427022
Biotype: lincRNA
Gene id: ENSG00000214955
Gene Name: AP000318.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:34205099-34205127
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-125a-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107093-116107121
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207815266-207815294
exon
HITS-CLIP
DIRECT
LncBasev2
1:207811710-207811738
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf220
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000521244
Biotype: lincRNA
Gene id: ENSG00000213057
Gene Name: C1orf220
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:178547286-178547314
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524183-140524211
exon
HITS-CLIP
DIRECT
LncBasev2
8:140523961-140523989
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:140523961-140523989
exon
HITS-CLIP
DIRECT
LncBasev2
8:140524183-140524211
exon
HITS-CLIP
DIRECT
LncBasev2
8:140524183-140524211
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524183-140524211
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37204650-37204678
exon
PAR-CLIP
DIRECT
LncBasev2
CHKB-CPT1B
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_027928.2
Biotype: sense
Gene id: NR_027928.2 (gene)
Gene Name: CHKB-CPT1B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:50582308-50582336
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:480514-480542
exon
HITS-CLIP
DIRECT
LncBasev2
5:479233-479261
exon
HITS-CLIP
DIRECT
LncBasev2
5:479446-479474
exon
HITS-CLIP
DIRECT
LncBasev2
5:480514-480542
exon
HITS-CLIP
DIRECT
LncBasev2
5:479233-479261
exon
HITS-CLIP
DIRECT
LncBasev2
5:479446-479484
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607286
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:473358-473386
exon
HITS-CLIP
DIRECT
LncBasev2
5:475184-475212
exon
HITS-CLIP
DIRECT
LncBasev2
5:475184-475212
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2256P15.5
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607847
Biotype: lincRNA
Gene id: ENSG00000271715
Gene Name: CTD-2256P15.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:10269815-10269843
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2303H24.2
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425211
Biotype: processed_transcript
Gene id: ENSG00000273018
Gene Name: CTD-2303H24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:18511310-18511338
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2517M22.14
hsa-miR-125a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000569326
Biotype: retained_intron
Gene id: ENSG00000255182
Gene Name: CTD-2517M22.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:144499389-144499417
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: