Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-125b-1-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC098614.2
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000368528
Biotype: processed_pseudogene
Gene id: ENSG00000213846
Gene Name: AC098614.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:27633551-27633579
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485317-105485345
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00263
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000454935
Biotype: lincRNA
Gene id: ENSG00000235823
Gene Name: LINC00263
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:100373796-100373824
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00263
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 10
Transcript: NR_026762.1
Biotype: lincRNA
Gene id: NR_026762.1 (gene)
Gene Name: LINC00263
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:100373796-100373824
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100829934-100829962
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65423286-65423314
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65423286-65423314
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-118K6.3
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000607898
Biotype: lincRNA
Gene id: ENSG00000273001
Gene Name: RP11-118K6.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:3065950-3065978
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-264B17.3
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000569969
Biotype: retained_intron
Gene id: ENSG00000261067
Gene Name: RP11-264B17.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
16:28979153-28979181
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-352E6.2
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000509155
Biotype: processed_pseudogene
Gene id: ENSG00000249780
Gene Name: RP11-352E6.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
4:12640543-12640571
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-391M1.4
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000607057
Biotype: lincRNA
Gene id: ENSG00000272452
Gene Name: RP11-391M1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
3:40466758-40466786
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-658F2.8
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000550837
Biotype: antisense
Gene id: ENSG00000258297
Gene Name: RP11-658F2.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
11:66668056-66668084
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-750B16.1
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000574371
Biotype: processed_pseudogene
Gene id: ENSG00000262902
Gene Name: RP11-750B16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:53106316-53106344
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
17:53106316-53106344
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-309I22.2
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:32861763-32861791
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-323P24.3
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000439622
Biotype: antisense
Gene id: ENSG00000226310
Gene Name: RP3-323P24.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
X:57121726-57121754
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-514P16.1
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000392722
Biotype: processed_pseudogene
Gene id: ENSG00000237682
Gene Name: RP3-514P16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:101539048-101539076
exon
HITS-CLIP
DIRECT
LncBasev2
RPS20P14
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000412545
Biotype: processed_pseudogene
Gene id: ENSG00000223803
Gene Name: RPS20P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:186900201-186900229
exon
HITS-CLIP
DIRECT
LncBasev2
SCDP1
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000455244
Biotype: processed_pseudogene
Gene id: ENSG00000226549
Gene Name: SCDP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
17:20785281-20785309
exon
HITS-CLIP
DIRECT
LncBasev2
TCEA1P2
hsa-miR-125b-1-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000420496
Biotype: processed_pseudogene
Gene id: ENSG00000230409
Gene Name: TCEA1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:37276501-37276529
exon
HITS-CLIP
DIRECT
LncBasev2
TSC22D1-AS1
hsa-miR-125b-1-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000616360
Biotype: antisense
Gene id: ENSG00000278156
Gene Name: TSC22D1-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-1-3p
Sequence: acggguuaggcucuugggagcu
MirBase ID: MIMAT0004592
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:44578982-44579010
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: