Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-125b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002116.8
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000473572
Biotype: retained_intron
Gene id: ENSG00000248101
Gene Name: AC002116.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:36011422-36011450
exon
HITS-CLIP
DIRECT
LncBasev2
AC004158.3
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000564508
Biotype: lincRNA
Gene id: ENSG00000260664
Gene Name: AC004158.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:72426593-72426621
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30633250-30633278
exon
HITS-CLIP
DIRECT
LncBasev2
AC005932.1
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601106
Biotype: antisense
Gene id: ENSG00000269019
Gene Name: AC005932.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:18946335-18946363
exon
HITS-CLIP
DIRECT
LncBasev2
AC007387.2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000421570
Biotype: processed_pseudogene
Gene id: ENSG00000224646
Gene Name: AC007387.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74754745-74754773
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74754745-74754773
exon
HITS-CLIP
DIRECT
LncBasev2
AC008982.2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600473
Biotype: sense_intronic
Gene id: ENSG00000269688
Gene Name: AC008982.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:38845451-38845479
exon
HITS-CLIP
DIRECT
LncBasev2
AC009133.15
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566537
Biotype: antisense
Gene id: ENSG00000259952
Gene Name: AC009133.15
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:29807479-29807507
exon
HITS-CLIP
DIRECT
LncBasev2
AC009506.2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420635
Biotype: processed_pseudogene
Gene id: ENSG00000225369
Gene Name: AC009506.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:159463114-159463142
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195554912-195554940
exon
HITS-CLIP
DIRECT
LncBasev2
AC091878.1
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000399760
Biotype: antisense
Gene id: ENSG00000215196
Gene Name: AC091878.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:17216121-17216149
exon
HITS-CLIP
DIRECT
LncBasev2
AC103564.6
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432853
Biotype: unprocessed_pseudogene
Gene id: ENSG00000232760
Gene Name: AC103564.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131833794-131833822
exon
HITS-CLIP
DIRECT
LncBasev2
AC116366.6
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000443093
Biotype: antisense
Gene id: ENSG00000234290
Gene Name: AC116366.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132471263-132471291
exon
HITS-CLIP
DIRECT
LncBasev2
5:132471429-132471457
exon
HITS-CLIP
DIRECT
LncBasev2
ADIPOR1P2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554199
Biotype: processed_pseudogene
Gene id: ENSG00000258805
Gene Name: ADIPOR1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:94634008-94634036
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:94634008-94634036
exon
PAR-CLIP
DIRECT
LncBasev2
AF127936.7
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000432230
Biotype: lincRNA
Gene id: ENSG00000235609
Gene Name: AF127936.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:14823935-14823963
exon
HITS-CLIP
DIRECT
LncBasev2
AF131217.1
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000433310
Biotype: lincRNA
Gene id: ENSG00000232855
Gene Name: AF131217.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:28441638-28441666
exon
HITS-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
16:89995173-89995212
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:89994822-89994850
exon
PAR-CLIP
DIRECT
LncBasev2
ANKRD44-IT1
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000428191
Biotype: sense_intronic
Gene id: ENSG00000236977
Gene Name: ANKRD44-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:197301411-197301439
exon
HITS-CLIP
DIRECT
LncBasev2
ARHGEF26-AS1
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000491862
Biotype: antisense
Gene id: ENSG00000243069
Gene Name: ARHGEF26-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:154025169-154025197
exon
HITS-CLIP
DIRECT
LncBasev2
ARPC3P2
hsa-miR-125b-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000457786
Biotype: processed_pseudogene
Gene id: ENSG00000238137
Gene Name: ARPC3P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
1:211442274-211442302
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-125b-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-125b-5p
Sequence: ucccugagacccuaacuuguga
MirBase ID: MIMAT0000423
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
6:7882452-7882480
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: