Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-126-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTD-2369P2.2
hsa-miR-126-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000317726
Biotype: lincRNA
Gene id: ENSG00000175898
Gene Name: CTD-2369P2.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:10221838-10221866
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-126-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:27163709-27163737
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00106
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000430235
Biotype: lincRNA
Gene id: ENSG00000236871
Gene Name: LINC00106
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:1398936-1398964
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01000
hsa-miR-126-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_024368.1
Biotype: lincRNA
Gene id: NR_024368.1 (gene)
Gene Name: LINC01000
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:128659932-128659960
exon
HITS-CLIP
DIRECT
LncBasev2
MEF2C-AS1
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514571
Biotype: antisense
Gene id: ENSG00000248309
Gene Name: MEF2C-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:89168264-89168292
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-126-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65442958-65442986
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437635-65437663
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65437635-65437663
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-126-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
15:41304316-41304344
exon
HITS-CLIP
DIRECT
LncBasev2
PTGES3P1
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000439531
Biotype: processed_pseudogene
Gene id: ENSG00000234518
Gene Name: PTGES3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:89104739-89104767
exon
HITS-CLIP
DIRECT
LncBasev2
RNU6ATAC35P
hsa-miR-126-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000609276
Biotype: lincRNA
Gene id: ENSG00000221571
Gene Name: RNU6ATAC35P
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:220825895-220825923
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1085N6.5
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000557467
Biotype: lincRNA
Gene id: ENSG00000258776
Gene Name: RP11-1085N6.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
14:56817739-56817767
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-274B21.1
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000605862
Biotype: processed_transcript
Gene id: ENSG00000242588
Gene Name: RP11-274B21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:128625833-128625861
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-345N11.1
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000621819
Biotype: sense_intronic
Gene id: ENSG00000278840
Gene Name: RP11-345N11.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:26557924-26557952
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-813F11.4
hsa-miR-126-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000610021
Biotype: lincRNA
Gene id: ENSG00000273081
Gene Name: RP4-813F11.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:141003377-141003405
exon
HITS-CLIP
DIRECT
LncBasev2
RPL18AP3
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000462885
Biotype: processed_pseudogene
Gene id: ENSG00000213442
Gene Name: RPL18AP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Umbilical vein
HUVEC
IP
Tested Cell Line: HUVEC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:104265304-104265332
exon
HITS-CLIP
DIRECT
LncBasev2
SKP1P1
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000438081
Biotype: processed_pseudogene
Gene id: ENSG00000231234
Gene Name: SKP1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Umbilical vein
HUVEC
IP
Tested Cell Line: HUVEC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:66423435-66423463
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-126-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:73849606-73849634
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_000304
hsa-miR-126-3p
-
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00001041
Biotype: transcript isomorph
Gene id: XLOC_000304
Gene Name: XLOC_000304
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr1:94927728-94927756
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: