Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1273d

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
C1orf213
hsa-miR-1273d
IP

Gene Details
Chromosome: 1
Transcript: ENST00000335648
Biotype: antisense
Gene id: ENSG00000249087
Gene Name: C1orf213
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:23370249-23370277
exon
PAR-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-1273d
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65501594-65501622
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504754-65504782
exon
HITS-CLIP
DIRECT
LncBasev2
MIR663AHG
hsa-miR-1273d
IP

Gene Details
Chromosome: 20
Transcript: ENST00000427348
Biotype: lincRNA
Gene id: ENSG00000227195
Gene Name: MIR663AHG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Lung Normal/Primary
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:26209155-26209183
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-108M9.3
hsa-miR-1273d
IP

Gene Details
Chromosome: 1
Transcript: ENST00000438002
Biotype: lincRNA
Gene id: ENSG00000228549
Gene Name: RP11-108M9.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:16872609-16872637
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-561L24.3
hsa-miR-1273d
IP

Gene Details
Chromosome: 1
Transcript: ENST00000565336
Biotype: lincRNA
Gene id: ENSG00000260464
Gene Name: RP4-561L24.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:93847612-93847640
exon
HITS-CLIP
DIRECT
LncBasev2
RPL18AP3
hsa-miR-1273d
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000462885
Biotype: processed_pseudogene
Gene id: ENSG00000213442
Gene Name: RPL18AP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1273d
Sequence: gaacccaugagguugaggcugcagu
MirBase ID: MIMAT0015090
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:104265624-104265652
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: