Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-129-2-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC003092.1
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000415536
Biotype: lincRNA
Gene id: ENSG00000236453
Gene Name: AC003092.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:94064634-94064662
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201057-176201085
exon
HITS-CLIP
DIRECT
LncBasev2
AC073869.1
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000623617
Biotype: processed_transcript
Gene id: ENSG00000233087
Gene Name: AC073869.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131363277-131363305
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195554914-195554942
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948435-30948463
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD19P
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000473204
Biotype: processed_transcript
Gene id: ENSG00000187984
Gene Name: ANKRD19P
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
9:92809760-92809788
exon
HITS-CLIP
DIRECT
LncBasev2
AP000436.4
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605239
Biotype: processed_pseudogene
Gene id: ENSG00000270775
Gene Name: AP000436.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:65026416-65026444
exon
HITS-CLIP
DIRECT
LncBasev2
BRD2-IT1
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415875
Biotype: sense_intronic
Gene id: ENSG00000223837
Gene Name: BRD2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:32970874-32970902
exon
HITS-CLIP
DIRECT
LncBasev2
6:32970874-32970902
exon
HITS-CLIP
DIRECT
LncBasev2
6:32970874-32970902
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207808594-207808622
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207815474-207815502
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:28941004-28941032
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:48479872-48479900
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479753-48479781
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479872-48479900
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-459F4.3
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:27795160-27795188
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606319
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:476026-476054
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479479-479507
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2587M2.1
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000512693
Biotype: lincRNA
Gene id: ENSG00000249476
Gene Name: CTD-2587M2.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:109325530-109325558
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2622I13.3
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600056
Biotype: sense_intronic
Gene id: ENSG00000268670
Gene Name: CTD-2622I13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:4061833-4061861
exon
HITS-CLIP
DIRECT
LncBasev2
DGCR5
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000438934
Biotype: antisense
Gene id: ENSG00000237517
Gene Name: DGCR5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:18991271-18991299
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-129-2-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360341-55360369
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106698519-106698547
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-129-2-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-2-3p
Sequence: aagcccuuaccccaaaaagcau
MirBase ID: MIMAT0004605
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652398-14652426
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: