Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-129-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005154.6
hsa-miR-129-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000581794
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30566388-30566426
exon
HITS-CLIP
DIRECT
LncBasev2
AC005592.1
hsa-miR-129-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000432677
Biotype: lincRNA
Gene id: ENSG00000236714
Gene Name: AC005592.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:142760934-142760962
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-129-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159360-30159388
exon
HITS-CLIP
DIRECT
LncBasev2
AC009120.6
hsa-miR-129-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000621548
Biotype: lincRNA
Gene id: ENSG00000259972
Gene Name: AC009120.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:74306303-74306331
exon
HITS-CLIP
DIRECT
LncBasev2
AC027612.1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000413684
Biotype: processed_pseudogene
Gene id: ENSG00000232531
Gene Name: AC027612.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:91748488-91748516
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532910-62532938
exon
HITS-CLIP
DIRECT
LncBasev2
AL132709.8
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000442197
Biotype: lincRNA
Gene id: ENSG00000232018
Gene Name: AL132709.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100967023-100967051
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5A1P2
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000616464
Biotype: processed_transcript
Gene id: ENSG00000227682
Gene Name: ATP5A1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:155270017-155270045
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-129-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7882634-7882662
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-129-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207819064-207819092
exon
HITS-CLIP
DIRECT
LncBasev2
CACYBPP2
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000453625
Biotype: processed_pseudogene
Gene id: ENSG00000177855
Gene Name: CACYBPP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:183607689-183607719
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-129-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:140521098-140521126
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521098-140521126
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521098-140521126
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140523370-140523398
exon
HITS-CLIP
DIRECT
LncBasev2
8:140522263-140522291
exon
HITS-CLIP
DIRECT
LncBasev2
CCT5P2
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000432974
Biotype: processed_pseudogene
Gene id: ENSG00000230584
Gene Name: CCT5P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:78909617-78909647
exon
HITS-CLIP
DIRECT
LncBasev2
CCT8P1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000413611
Biotype: processed_pseudogene
Gene id: ENSG00000226015
Gene Name: CCT8P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147204679-147204707
exon
HITS-CLIP
DIRECT
LncBasev2
CEP57L1P1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000430943
Biotype: processed_pseudogene
Gene id: ENSG00000224725
Gene Name: CEP57L1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:70389881-70389909
exon
HITS-CLIP
DIRECT
LncBasev2
CRHR1-IT1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000578000
Biotype: processed_transcript
Gene id: ENSG00000204650
Gene Name: CRHR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:45641053-45641087
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-315H11.2
hsa-miR-129-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000619486
Biotype: sense_intronic
Gene id: ENSG00000274080
Gene Name: CTA-315H11.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:73610475-73610505
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-129-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:149495808-149495836
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-129-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:57307482-57307510
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2262B20.1
hsa-miR-129-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559487
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000259630
Gene Name: CTD-2262B20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-129-5p
Sequence: cuuuuugcggucugggcuugc
MirBase ID: MIMAT0000242
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:85415351-85415379
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: