Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1293

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC006548.28
hsa-miR-1293
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:17033094-17033122
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32A-IT1
hsa-miR-1293
IP

Gene Details
Chromosome: 15
Transcript: NR_026808.1
Biotype: sense
Gene id: NR_026808.1 (gene)
Gene Name: ANP32A-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:68806246-68806274
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-1293
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207806417-207806445
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-1293
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
8:140529209-140529237
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-1293
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:136804675-136804703
exon
HITS-CLIP
DIRECT
LncBasev2
9:136804003-136804042
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-1293
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:29053768-29053796
exon
HITS-CLIP
DIRECT
LncBasev2
22:29031224-29031252
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-250D10.23
hsa-miR-1293
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566575
Biotype: lincRNA
Gene id: ENSG00000260655
Gene Name: CTA-250D10.23
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:41922634-41922662
exon
HITS-CLIP
DIRECT
LncBasev2
22:41922841-41922883
exon
HITS-CLIP
DIRECT
LncBasev2
22:41922666-41922694
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-425O23.2
hsa-miR-1293
IP

Gene Details
Chromosome: 19
Transcript: ENST00000378432
Biotype: sense_intronic
Gene id: ENSG00000205041
Gene Name: CTC-425O23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:40274762-40274790
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-1293
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:478503-478531
exon
HITS-CLIP
DIRECT
LncBasev2
5:479060-479088
exon
HITS-CLIP
DIRECT
LncBasev2
5:478717-478745
exon
HITS-CLIP
DIRECT
LncBasev2
5:478273-478301
exon
HITS-CLIP
DIRECT
LncBasev2
5:480738-480766
exon
HITS-CLIP
DIRECT
LncBasev2
5:478717-478745
exon
HITS-CLIP
DIRECT
LncBasev2
5:478273-478301
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-1293
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:477919-477947
exon
HITS-CLIP
DIRECT
LncBasev2
5:477919-477947
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-1293
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606107
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:477212-477240
exon
HITS-CLIP
DIRECT
LncBasev2
5:477212-477240
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2517M22.14
hsa-miR-1293
IP

Gene Details
Chromosome: 8
Transcript: ENST00000528207
Biotype: retained_intron
Gene id: ENSG00000255182
Gene Name: CTD-2517M22.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:144496327-144496355
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2587H24.14
hsa-miR-1293
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586923
Biotype: retained_intron
Gene id: ENSG00000276570
Gene Name: CTD-2587H24.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:55230127-55230155
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2622I13.3
hsa-miR-1293
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600056
Biotype: sense_intronic
Gene id: ENSG00000268670
Gene Name: CTD-2622I13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:4062203-4062231
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-1293
IP

Gene Details
Chromosome: 3
Transcript: ENST00000426200
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:14948022-14948050
exon
HITS-CLIP
DIRECT
LncBasev2
GAPDHP44
hsa-miR-1293
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000513513
Biotype: processed_pseudogene
Gene id: ENSG00000213352
Gene Name: GAPDHP44
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:62755753-62755781
exon
HITS-CLIP
DIRECT
LncBasev2
H1FX-AS1
hsa-miR-1293
IP

Gene Details
Chromosome: 3
Transcript: ENST00000511998
Biotype: antisense
Gene id: ENSG00000206417
Gene Name: H1FX-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:129317189-129317217
exon
HITS-CLIP
DIRECT
LncBasev2
H1FX-AS1
hsa-miR-1293
IP

Gene Details
Chromosome: 3
Transcript: NR_026991.1
Biotype: antisense
Gene id: NR_026991.1 (gene)
Gene Name: H1FX-AS1
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:129317189-129317217
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPKP4
hsa-miR-1293
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000485383
Biotype: processed_pseudogene
Gene id: ENSG00000243547
Gene Name: HNRNPKP4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:96349877-96349905
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-1293
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-1293
Sequence: uggguggucuggagauuugugc
MirBase ID: MIMAT0005883
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
7:27163085-27163113
exon
HITS-CLIP
DIRECT
LncBasev2
7:27163085-27163113
exon
HITS-CLIP
DIRECT
LncBasev2
7:27163085-27163113
exon
HITS-CLIP
DIRECT
LncBasev2
7:27163505-27163533
exon
HITS-CLIP
DIRECT
LncBasev2
7:27163505-27163533
exon
HITS-CLIP
DIRECT
LncBasev2
7:27163085-27163113
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: