Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1294

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTD-2006K23.1
hsa-miR-1294
IP

Gene Details
Chromosome: 17
Transcript: ENST00000569279
Biotype: lincRNA
Gene id: ENSG00000261222
Gene Name: CTD-2006K23.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD3
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:74604111-74604139
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_003809
hsa-miR-1294
IP

Gene Details
Chromosome: chr4
Transcript: TCONS_00008359
Biotype: transcript isomorph
Gene id: XLOC_003809
Gene Name: XLOC_003809
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr4:184845291-184845319
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: