Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
GAPDHP1
hsa-miR-1302
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000452570
Biotype: processed_pseudogene
Gene id: ENSG00000228232
Gene Name: GAPDHP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:39787749-39787777
exon
HITS-CLIP
DIRECT
LncBasev2
PFN1P12
hsa-miR-1302
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000455938
Biotype: processed_pseudogene
Gene id: ENSG00000226028
Gene Name: PFN1P12
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:143620002-143620030
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: