Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-135b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004453.8
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000487895
Biotype: processed_pseudogene
Gene id: ENSG00000146677
Gene Name: AC004453.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:44468201-44468229
exon
HITS-CLIP
DIRECT
LncBasev2
AC010878.3
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000456500
Biotype: processed_pseudogene
Gene id: ENSG00000225402
Gene Name: AC010878.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:37817836-37817864
exon
HITS-CLIP
DIRECT
LncBasev2
AC073869.1
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000623617
Biotype: processed_transcript
Gene id: ENSG00000233087
Gene Name: AC073869.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131363283-131363311
exon
HITS-CLIP
DIRECT
LncBasev2
ANXA2P2
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000435128
Biotype: processed_pseudogene
Gene id: ENSG00000231991
Gene Name: ANXA2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33624383-33624411
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646203-116646231
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-135b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528172-140528200
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140528172-140528200
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-135b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29140306-29140334
exon
HITS-CLIP
DIRECT
LncBasev2
CRHR1-IT1
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000455565
Biotype: processed_transcript
Gene id: ENSG00000204650
Gene Name: CRHR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:45630104-45630132
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-451P13.1
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000474167
Biotype: processed_pseudogene
Gene id: ENSG00000213757
Gene Name: CTC-451P13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:79284332-79284360
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2192J16.15
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000325000
Biotype: processed_pseudogene
Gene id: ENSG00000178464
Gene Name: CTD-2192J16.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12643870-12643898
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2196E14.3
hsa-miR-135b-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000561764
Biotype: antisense
Gene id: ENSG00000261723
Gene Name: CTD-2196E14.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:23617667-23617695
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-135b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479237-479265
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2666L21.3
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000461223
Biotype: processed_pseudogene
Gene id: ENSG00000213293
Gene Name: CTD-2666L21.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:12260531-12260559
exon
HITS-CLIP
DIRECT
LncBasev2
19:12260428-12260456
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485156-105485184
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1B2P3
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000447718
Biotype: processed_pseudogene
Gene id: ENSG00000232472
Gene Name: EEF1B2P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24788674-24788702
exon
HITS-CLIP
DIRECT
LncBasev2
ENO1P4
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416471
Biotype: processed_pseudogene
Gene id: ENSG00000241790
Gene Name: ENO1P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:201622897-201622925
exon
HITS-CLIP
DIRECT
LncBasev2
FKBP4P1
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000507284
Biotype: processed_pseudogene
Gene id: ENSG00000251463
Gene Name: FKBP4P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:118194473-118194501
exon
PAR-CLIP
DIRECT
LncBasev2
FTH1P8
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000498161
Biotype: processed_pseudogene
Gene id: ENSG00000219507
Gene Name: FTH1P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:148052619-148052647
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-135b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000431268
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866721-173866749
exon
HITS-CLIP
DIRECT
LncBasev2
H1FX-AS1
hsa-miR-135b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: NR_026991.1
Biotype: antisense
Gene id: NR_026991.1 (gene)
Gene Name: H1FX-AS1
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-135b-5p
Sequence: uauggcuuuucauuccuauguga
MirBase ID: MIMAT0000758
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:129316996-129317024
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: