Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-145-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005154.6
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000579174
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30574707-30574735
exon
HITS-CLIP
DIRECT
LncBasev2
AC005255.3
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593748
Biotype: processed_pseudogene
Gene id: ENSG00000256210
Gene Name: AC005255.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:14792388-14792432
exon
HITS-CLIP
DIRECT
LncBasev2
AC005618.6
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606901
Biotype: lincRNA
Gene id: ENSG00000272070
Gene Name: AC005618.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:141327503-141327531
exon
HITS-CLIP
DIRECT
LncBasev2
AC006129.2
hsa-miR-145-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601116
Biotype: lincRNA
Gene id: ENSG00000268027
Gene Name: AC006129.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:41550219-41550247
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-145-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39599792-39599820
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39599721-39599749
exon
HITS-CLIP
DIRECT
LncBasev2
AC007318.5
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000467568
Biotype: processed_pseudogene
Gene id: ENSG00000172974
Gene Name: AC007318.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:65205203-65205231
exon
HITS-CLIP
DIRECT
LncBasev2
AC010096.1
hsa-miR-145-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443897
Biotype: lincRNA
Gene id: ENSG00000234597
Gene Name: AC010096.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:19458342-19458370
exon
HITS-CLIP
DIRECT
LncBasev2
AC024560.3
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000449003
Biotype: retained_intron
Gene id: ENSG00000214135
Gene Name: AC024560.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:197615027-197615055
exon
HITS-CLIP
DIRECT
LncBasev2
AC068491.3
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449539
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000223973
Gene Name: AC068491.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:111384137-111384165
exon
HITS-CLIP
DIRECT
LncBasev2
AC073869.1
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000623617
Biotype: processed_transcript
Gene id: ENSG00000233087
Gene Name: AC073869.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131363240-131363268
exon
HITS-CLIP
DIRECT
LncBasev2
AC074183.4
hsa-miR-145-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000439105
Biotype: lincRNA
Gene id: ENSG00000232019
Gene Name: AC074183.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:84939935-84939978
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532874-62532902
exon
HITS-CLIP
DIRECT
LncBasev2
AC098614.2
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000368528
Biotype: processed_pseudogene
Gene id: ENSG00000213846
Gene Name: AC098614.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:27633587-27633615
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP14
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000411655
Biotype: processed_pseudogene
Gene id: ENSG00000229001
Gene Name: ACTBP14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:69023391-69023419
exon
HITS-CLIP
DIRECT
LncBasev2
AF196970.3
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000416061
Biotype: antisense
Gene id: ENSG00000232828
Gene Name: AF196970.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:48737139-48737167
exon
PAR-CLIP
DIRECT
LncBasev2
AP000254.8
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000609934
Biotype: antisense
Gene id: ENSG00000273271
Gene Name: AP000254.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:31667176-31667204
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-145-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7899604-7899632
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7899604-7899640
exon
HITS-CLIP
DIRECT
LncBasev2
6:7899604-7899640
exon
HITS-CLIP
DIRECT
LncBasev2
BRD7P4
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406170
Biotype: processed_pseudogene
Gene id: ENSG00000218676
Gene Name: BRD7P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:111430924-111430952
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-145-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207808552-207808580
exon
HITS-CLIP
DIRECT
LncBasev2
CACYBPP2
hsa-miR-145-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000453625
Biotype: processed_pseudogene
Gene id: ENSG00000177855
Gene Name: CACYBPP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:183607836-183607864
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: