Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-146b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC009506.1
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000418474
Biotype: antisense
Gene id: ENSG00000224152
Gene Name: AC009506.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:159615791-159615819
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195554913-195554941
exon
HITS-CLIP
DIRECT
LncBasev2
AC113189.5
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000573187
Biotype: antisense
Gene id: ENSG00000233223
Gene Name: AC113189.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:7583223-7583251
exon
PAR-CLIP
DIRECT
LncBasev2
17:7583223-7583251
exon
PAR-CLIP
DIRECT
LncBasev2
ALOX15P2
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000340858
Biotype: unprocessed_pseudogene
Gene id: ENSG00000188101
Gene Name: ALOX15P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
9:92919944-92919972
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD19P
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000473204
Biotype: processed_transcript
Gene id: ENSG00000187984
Gene Name: ANKRD19P
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
9:92809759-92809787
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5F1P1
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000433775
Biotype: processed_pseudogene
Gene id: ENSG00000224451
Gene Name: ATP5F1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:51598502-51598530
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
1:207806468-207806496
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-113I20.2
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606089
Biotype: lincRNA
Gene id: ENSG00000271737
Gene Name: CTB-113I20.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:134005264-134005292
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-134H23.3
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562618
Biotype: processed_transcript
Gene id: ENSG00000260908
Gene Name: CTB-134H23.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:29107524-29107552
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:48479752-48479780
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-308K20.3
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000523057
Biotype: processed_pseudogene
Gene id: ENSG00000253785
Gene Name: CTC-308K20.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:172975799-172975827
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57306010-57306038
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:479187-479235
exon
HITS-CLIP
DIRECT
LncBasev2
5:480476-480504
exon
HITS-CLIP
DIRECT
LncBasev2
5:479187-479235
exon
HITS-CLIP
DIRECT
LncBasev2
5:479262-479290
exon
HITS-CLIP
DIRECT
LncBasev2
5:480264-480292
exon
HITS-CLIP
DIRECT
LncBasev2
5:478488-478516
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:477934-477962
exon
HITS-CLIP
DIRECT
LncBasev2
5:477934-477962
exon
HITS-CLIP
DIRECT
LncBasev2
5:478005-478033
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606319
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:476025-476053
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2281E23.2
hsa-miR-146b-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000520524
Biotype: lincRNA
Gene id: ENSG00000254269
Gene Name: CTD-2281E23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:1104858-1104886
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2319I12.4
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000586143
Biotype: retained_intron
Gene id: ENSG00000267248
Gene Name: CTD-2319I12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:60134660-60134688
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2517M22.17
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000580385
Biotype: antisense
Gene id: ENSG00000265393
Gene Name: CTD-2517M22.17
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:144512628-144512682
exon
HITS-CLIP
DIRECT
LncBasev2
8:144512645-144512682
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2587H24.14
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586923
Biotype: retained_intron
Gene id: ENSG00000276570
Gene Name: CTD-2587H24.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:55227354-55227382
exon
HITS-CLIP
DIRECT
LncBasev2
19:55228647-55228675
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-146b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-3p
Sequence: ugcccuguggacucaguucugg
MirBase ID: MIMAT0004766
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360342-55360370
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: