Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-146b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004938.5
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000438468
Biotype: processed_pseudogene
Gene id: ENSG00000225443
Gene Name: AC004938.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
7:44511022-44511050
exon
HITS-CLIP
DIRECT
LncBasev2
AC012123.1
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000426194
Biotype: antisense
Gene id: ENSG00000228835
Gene Name: AC012123.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:32773433-32773461
exon
PAR-CLIP
DIRECT
LncBasev2
AC012309.5
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263175-37263203
exon
HITS-CLIP
DIRECT
LncBasev2
AC074117.10
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000447070
Biotype: antisense
Gene id: ENSG00000234072
Gene Name: AC074117.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27357928-27357956
exon
PAR-CLIP
DIRECT
LncBasev2
AP000265.1
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000565959
Biotype: lincRNA
Gene id: ENSG00000261610
Gene Name: AP000265.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:32260305-32260333
exon
HITS-CLIP
DIRECT
LncBasev2
ATF4P4
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000393544
Biotype: processed_transcript
Gene id: ENSG00000256167
Gene Name: ATF4P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:113790205-113790233
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207810505-207810533
exon
HITS-CLIP
DIRECT
LncBasev2
1:207812542-207812570
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:140521207-140521235
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521207-140521235
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521207-140521235
exon
PAR-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
9:136804037-136804065
exon
HITS-CLIP
DIRECT
LncBasev2
9:136804037-136804065
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:29112361-29112389
exon
HITS-CLIP
DIRECT
LncBasev2
CLUHP3
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562354
Biotype: processed_transcript
Gene id: ENSG00000131797
Gene Name: CLUHP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:31708822-31708850
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
22:28788990-28789018
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-55B8.1
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000470806
Biotype: processed_pseudogene
Gene id: ENSG00000243538
Gene Name: CTB-55B8.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:16902279-16902307
exon
HITS-CLIP
DIRECT
LncBasev2
5:16902279-16902307
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57308094-57308122
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:480109-480137
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3234P18.6
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000611182
Biotype: lincRNA
Gene id: ENSG00000276071
Gene Name: CTD-3234P18.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36668787-36668815
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-146b-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360195-55360223
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P38
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000567658
Biotype: processed_pseudogene
Gene id: ENSG00000261557
Gene Name: EEF1A1P38
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:27134057-27134085
exon
HITS-CLIP
DIRECT
LncBasev2
ENO1P1
hsa-miR-146b-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366587
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000244457
Gene Name: ENO1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:236483609-236483637
exon
HITS-CLIP
DIRECT
LncBasev2
FTX
hsa-miR-146b-5p
IP

Gene Details
Chromosome: X
Transcript: ENST00000602812
Biotype: lincRNA
Gene id: ENSG00000230590
Gene Name: FTX
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-146b-5p
Sequence: ugagaacugaauuccauaggcu
MirBase ID: MIMAT0002809
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:74028872-74028900
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: