Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-181d-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTD-2544L4.1
hsa-miR-181d-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000523800
Biotype: processed_pseudogene
Gene id: ENSG00000253107
Gene Name: CTD-2544L4.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:110555866-110555894
exon
PAR-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:14944528-14944556
exon
PAR-CLIP
DIRECT
LncBasev2
LINC00667
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000582008
Biotype: lincRNA
Gene id: ENSG00000263753
Gene Name: LINC00667
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
18:5244908-5244936
exon
PAR-CLIP
DIRECT
LncBasev2
LOC100129034
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 9
Transcript: NR_027406.1
Biotype: antisense
Gene id: NR_027406.1 (gene)
Gene Name: LOC100129034
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:124357386-124357414
exon
PAR-CLIP
DIRECT
LncBasev2
PA2G4P4
hsa-miR-181d-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473864
Biotype: processed_pseudogene
Gene id: ENSG00000230457
Gene Name: PA2G4P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:156809812-156809840
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-215G15.5
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607560
Biotype: lincRNA
Gene id: ENSG00000272016
Gene Name: RP11-215G15.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:10657397-10657425
exon
PAR-CLIP
DIRECT
LncBasev2
5:10657397-10657425
exon
PAR-CLIP
DIRECT
LncBasev2
5:10657397-10657425
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-344E13.3
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000577537
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:20903561-20903589
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-42O15.3
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000607679
Biotype: lincRNA
Gene id: ENSG00000271992
Gene Name: RP11-42O15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:70445295-70445323
exon
PAR-CLIP
DIRECT
LncBasev2
TRG-AS1
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:38378552-38378580
exon
PAR-CLIP
DIRECT
LncBasev2
TUG1
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000519077
Biotype: antisense
Gene id: ENSG00000253352
Gene Name: TUG1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:30971045-30971073
exon
PAR-CLIP
DIRECT
LncBasev2
22:30971045-30971073
exon
PAR-CLIP
DIRECT
LncBasev2
XLOC_003433
hsa-miR-181d-5p
IP

Gene Details
Chromosome: chr4
Transcript: TCONS_00007381
Biotype: transcript isomorph
Gene id: XLOC_003433
Gene Name: XLOC_003433
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
chr4:4764390-4764418
exon
PAR-CLIP
DIRECT
LncBasev2
ZFAS1
hsa-miR-181d-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000450535
Biotype: antisense
Gene id: ENSG00000177410
Gene Name: ZFAS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-181d-5p
Sequence: aacauucauuguugucggugggu
MirBase ID: MIMAT0002821
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:49289166-49289194
exon
PAR-CLIP
DIRECT
LncBasev2
Funded by: