Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-183-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC006509.4
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000419124
Biotype: processed_pseudogene
Gene id: ENSG00000224443
Gene Name: AC006509.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:47705846-47705874
exon
HITS-CLIP
DIRECT
LncBasev2
AC007919.18
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000429380
Biotype: processed_pseudogene
Gene id: ENSG00000224611
Gene Name: AC007919.18
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:172522222-172522250
exon
HITS-CLIP
DIRECT
LncBasev2
AC079753.4
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000312918
Biotype: processed_pseudogene
Gene id: ENSG00000180152
Gene Name: AC079753.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:112853794-112853822
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-183-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57307734-57307762
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-499B15.4
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000424938
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000267343
Gene Name: CTC-499B15.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:11685593-11685621
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2541M15.4
hsa-miR-183-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000607697
Biotype: lincRNA
Gene id: ENSG00000271927
Gene Name: CTD-2541M15.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:6646910-6646938
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P7
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000596811
Biotype: processed_pseudogene
Gene id: ENSG00000268222
Gene Name: EEF1A1P7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:35383659-35383687
exon
HITS-CLIP
DIRECT
LncBasev2
FKBP4P1
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000507284
Biotype: processed_pseudogene
Gene id: ENSG00000251463
Gene Name: FKBP4P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
4:118193992-118194020
exon
HITS-CLIP
DIRECT
LncBasev2
GMFBP1
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000467831
Biotype: processed_pseudogene
Gene id: ENSG00000243495
Gene Name: GMFBP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
3:100665320-100665348
exon
HITS-CLIP
DIRECT
LncBasev2
HCG11
hsa-miR-183-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000411553
Biotype: lincRNA
Gene id: ENSG00000228223
Gene Name: HCG11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
6:26523535-26523563
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPU-AS1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366527
Biotype: antisense
Gene id: ENSG00000188206
Gene Name: HNRNPU-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
1:244844329-244844357
exon
HITS-CLIP
DIRECT
LncBasev2
1:244844329-244844357
exon
HITS-CLIP
DIRECT
LncBasev2
1:244844329-244844357
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-miR-183-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:27163059-27163087
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-183-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
20:36046135-36046163
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36047556-36047584
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65504967-65504995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503658-65503686
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500271-65500299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503658-65503686
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504967-65504995
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500271-65500299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503658-65503686
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500271-65500299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65500271-65500299
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504967-65504995
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504967-65504995
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504967-65504995
exon
HITS-CLIP
DIRECT
LncBasev2
MIR222HG
hsa-miR-183-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000602507
Biotype: lincRNA
Gene id: ENSG00000270069
Gene Name: MIR222HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:45769079-45769107
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65426249-65426277
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436471-65436499
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65428165-65428193
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436471-65436499
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65426249-65426277
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:41299689-41299717
exon
HITS-CLIP
DIRECT
LncBasev2
15:41299689-41299717
exon
HITS-CLIP
DIRECT
LncBasev2
RBM26-AS1
hsa-miR-183-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000606049
Biotype: antisense
Gene id: ENSG00000227354
Gene Name: RBM26-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
13:79422825-79422853
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-145M9.4
hsa-miR-183-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000595265
Biotype: lincRNA
Gene id: ENSG00000269728
Gene Name: RP11-145M9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
3:179396161-179396189
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: