Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-183-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005562.1
hsa-miR-183-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608512-30608540
exon
HITS-CLIP
DIRECT
LncBasev2
AC006011.4
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442758
Biotype: processed_pseudogene
Gene id: ENSG00000244563
Gene Name: AC006011.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:127846842-127846870
exon
HITS-CLIP
DIRECT
LncBasev2
AC007038.7
hsa-miR-183-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000452057
Biotype: antisense
Gene id: ENSG00000229127
Gene Name: AC007038.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:210032188-210032216
exon
HITS-CLIP
DIRECT
LncBasev2
AC007038.7
hsa-miR-183-5p
IP

Gene Details
Chromosome: 2
Transcript: NR_110291.1
Biotype: antisense
Gene id: NR_110291.1 (gene)
Gene Name: AC007038.7
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:210032188-210032216
exon
HITS-CLIP
DIRECT
LncBasev2
AC012309.5
hsa-miR-183-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263219-37263247
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
2:176201250-176201278
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201250-176201278
exon
HITS-CLIP
DIRECT
LncBasev2
AC090627.1
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000421610
Biotype: antisense
Gene id: ENSG00000235300
Gene Name: AC090627.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:48294341-48294369
exon
HITS-CLIP
DIRECT
LncBasev2
AC108004.2
hsa-miR-183-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000576171
Biotype: lincRNA
Gene id: ENSG00000273172
Gene Name: AC108004.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:184189-184217
exon
HITS-CLIP
DIRECT
LncBasev2
AC140076.1
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000449897
Biotype: processed_pseudogene
Gene id: ENSG00000227309
Gene Name: AC140076.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:17465349-17465377
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:17465349-17465377
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-183-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7882495-7882523
exon
HITS-CLIP
DIRECT
LncBasev2
C20orf166-AS1
hsa-miR-183-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000475015
Biotype: antisense
Gene id: ENSG00000174403
Gene Name: C20orf166-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
20:62544870-62544898
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-183-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524466-140524494
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527781-140527809
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526506-140526534
exon
HITS-CLIP
DIRECT
LncBasev2
CD27-AS1
hsa-miR-183-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000535639
Biotype: retained_intron
Gene id: ENSG00000215039
Gene Name: CD27-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:6439459-6439487
exon
HITS-CLIP
DIRECT
LncBasev2
COX7A2P2
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000505291
Biotype: processed_pseudogene
Gene id: ENSG00000236764
Gene Name: COX7A2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:96902982-96903010
exon
HITS-CLIP
DIRECT
LncBasev2
4:96902982-96903010
exon
HITS-CLIP
DIRECT
LncBasev2
CRHR1-IT1
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000455565
Biotype: processed_transcript
Gene id: ENSG00000204650
Gene Name: CRHR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:45636522-45636561
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-183-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494830-149494858
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494830-149494858
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494830-149494858
exon
PAR-CLIP
DIRECT
LncBasev2
5:149495160-149495188
exon
PAR-CLIP
DIRECT
LncBasev2
CTC-308K20.3
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000523057
Biotype: processed_pseudogene
Gene id: ENSG00000253785
Gene Name: CTC-308K20.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:172975773-172975801
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2196E14.3
hsa-miR-183-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000561764
Biotype: antisense
Gene id: ENSG00000261723
Gene Name: CTD-2196E14.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:23617667-23617695
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.1
hsa-miR-183-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000509301
Biotype: processed_pseudogene
Gene id: ENSG00000250645
Gene Name: CTD-2228K2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:418843-418871
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-183-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-183-5p
Sequence: uauggcacugguagaauucacu
MirBase ID: MIMAT0000261
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479237-479265
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: