Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-187-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTC-479C5.10
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000572067
Biotype: lincRNA
Gene id: ENSG00000263126
Gene Name: CTC-479C5.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:67882694-67882722
exon
HITS-CLIP
DIRECT
LncBasev2
FAR1-IT1
hsa-miR-187-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000525233
Biotype: sense_intronic
Gene id: ENSG00000254791
Gene Name: FAR1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:13669378-13669406
exon
HITS-CLIP
DIRECT
LncBasev2
KB-1980E6.2
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517692
Biotype: processed_pseudogene
Gene id: ENSG00000253923
Gene Name: KB-1980E6.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:102418140-102418168
exon
HITS-CLIP
DIRECT
LncBasev2
KB-226F1.2
hsa-miR-187-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000609736
Biotype: lincRNA
Gene id: ENSG00000272787
Gene Name: KB-226F1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:23969420-23969448
exon
HITS-CLIP
DIRECT
LncBasev2
LL22NC03-86G7.1
hsa-miR-187-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:21943182-21943210
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100270804
hsa-miR-187-3p
IP

Gene Details
Chromosome: 20
Transcript: NR_026885.1
Biotype: lincRNA
Gene id: NR_026885.1 (gene)
Gene Name: LOC100270804
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
20:18794699-18794727
exon
HITS-CLIP
DIRECT
LncBasev2
LOC254896
hsa-miR-187-3p
IP

Gene Details
Chromosome: 8
Transcript: NR_046173.1
Biotype: sense
Gene id: NR_046173.1 (gene)
Gene Name: LOC254896
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:23103229-23103257
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-1277A3.2
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499314
Biotype: processed_transcript
Gene id: ENSG00000246596
Gene Name: RP11-1277A3.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:177631369-177631397
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-365O16.1
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415453
Biotype: processed_pseudogene
Gene id: ENSG00000236773
Gene Name: RP11-365O16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
1:224175566-224175594
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:153282473-153282501
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-449O17.1
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000381645
Biotype: processed_transcript
Gene id: ENSG00000244627
Gene Name: RP3-449O17.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:38397329-38397357
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-1068E13.7
hsa-miR-187-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000609087
Biotype: lincRNA
Gene id: ENSG00000273148
Gene Name: RP5-1068E13.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
20:18794699-18794727
exon
HITS-CLIP
DIRECT
LncBasev2
RPL17P26
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000407033
Biotype: processed_pseudogene
Gene id: ENSG00000216854
Gene Name: RPL17P26
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:56871298-56871326
exon
HITS-CLIP
DIRECT
LncBasev2
TP73-AS1
hsa-miR-187-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000452079
Biotype: antisense
Gene id: ENSG00000227372
Gene Name: TP73-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:3746646-3746674
exon
HITS-CLIP
DIRECT
LncBasev2
TP73-AS1
hsa-miR-187-3p
IP

Gene Details
Chromosome: 1
Transcript: NR_033710.1
Biotype: antisense
Gene id: NR_033710.1 (gene)
Gene Name: TP73-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
1:3746646-3746674
exon
HITS-CLIP
DIRECT
LncBasev2
TRG-AS1
hsa-miR-187-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_040085.1
Biotype: lincRNA
Gene id: NR_040085.1 (gene)
Gene Name: TRG-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:38376244-38376272
exon
PAR-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-187-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
X:73821952-73821980
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844957-73844985
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844957-73844985
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844957-73844985
exon
HITS-CLIP
DIRECT
LncBasev2
X:73852530-73852558
exon
HITS-CLIP
DIRECT
LncBasev2
X:73821952-73821980
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844957-73844985
exon
HITS-CLIP
DIRECT
LncBasev2
X:73821952-73821980
exon
HITS-CLIP
DIRECT
LncBasev2
X:73844957-73844985
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_007800
hsa-miR-187-3p
-
IP

Gene Details
Chromosome: chr9
Transcript: TCONS_00016434
Biotype: transcript isomorph
Gene id: XLOC_007800
Gene Name: XLOC_007800
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr9:97895764-97895792
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_013473
hsa-miR-187-3p
IP

Gene Details
Chromosome: chr20
Transcript: TCONS_00028507
Biotype: transcript isomorph
Gene id: XLOC_013473
Gene Name: XLOC_013473
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-3p
Sequence: ucgugucuuguguugcagccgg
MirBase ID: MIMAT0000262
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr20:18794699-18794727
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: