Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-187-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC084082.3
hsa-miR-187-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113377-66113405
exon
HITS-CLIP
DIRECT
LncBasev2
8:66113377-66113405
exon
HITS-CLIP
DIRECT
LncBasev2
AC156455.1
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000538790
Biotype: lincRNA
Gene id: ENSG00000256546
Gene Name: AC156455.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:122068391-122068419
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646215-116646243
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-187-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526887-140526915
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-187-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149498819-149498847
exon
HITS-CLIP
DIRECT
LncBasev2
5:149496660-149496688
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2561B21.11
hsa-miR-187-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000572036
Biotype: lincRNA
Gene id: ENSG00000262873
Gene Name: CTD-2561B21.11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:81018000-81018028
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-187-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441810-16441838
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441668-16441696
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441668-16441696
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439670-16439698
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-187-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_045026.1
Biotype: lincRNA
Gene id: NR_045026.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439670-16439698
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-187-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36047137-36047165
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-187-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000497774
Biotype: retained_intron
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441668-16441696
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441668-16441696
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441810-16441838
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439670-16439698
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-187-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65430598-65430626
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65436699-65436727
exon
HITS-CLIP
DIRECT
LncBasev2
11:65429142-65429170
exon
HITS-CLIP
DIRECT
LncBasev2
PDIA3P1
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000471856
Biotype: processed_pseudogene
Gene id: ENSG00000180867
Gene Name: PDIA3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147178991-147179019
exon
HITS-CLIP
DIRECT
LncBasev2
RANP1
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000455094
Biotype: processed_pseudogene
Gene id: ENSG00000236603
Gene Name: RANP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:30486034-30486062
exon
HITS-CLIP
DIRECT
LncBasev2
6:30486034-30486062
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-314C16.1
hsa-miR-187-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_038979.1
Biotype: lincRNA
Gene id: NR_038979.1 (gene)
Gene Name: RP11-314C16.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:8436074-8436102
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-531A24.3
hsa-miR-187-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000564832
Biotype: lincRNA
Gene id: ENSG00000260838
Gene Name: RP11-531A24.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:72948365-72948393
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-723D22.2
hsa-miR-187-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000518535
Biotype: sense_intronic
Gene id: ENSG00000253586
Gene Name: RP11-723D22.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:38799733-38799761
exon
HITS-CLIP
DIRECT
LncBasev2
RP4-671O14.6
hsa-miR-187-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000624919
Biotype: sense_overlapping
Gene id: ENSG00000280434
Gene Name: RP4-671O14.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:44150677-44150705
exon
HITS-CLIP
DIRECT
LncBasev2
RPS23P8
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000429775
Biotype: processed_pseudogene
Gene id: ENSG00000230629
Gene Name: RPS23P8
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:70963010-70963038
exon
HITS-CLIP
DIRECT
LncBasev2
SNHG5
hsa-miR-187-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000369605
Biotype: lincRNA
Gene id: ENSG00000203875
Gene Name: SNHG5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:85677845-85677873
exon
HITS-CLIP
DIRECT
LncBasev2
SRP72P2
hsa-miR-187-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000344851
Biotype: processed_pseudogene
Gene id: ENSG00000188451
Gene Name: SRP72P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-187-5p
Sequence: ggcuacaacacaggacccgggc
MirBase ID: MIMAT0004561
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:158237488-158237516
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: