Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-193b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989021-51989049
exon
HITS-CLIP
DIRECT
LncBasev2
3:51989021-51989049
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989021-51989049
exon
HITS-CLIP
DIRECT
LncBasev2
AC005780.1
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592311
Biotype: lincRNA
Gene id: ENSG00000267320
Gene Name: AC005780.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:28317299-28317327
exon
HITS-CLIP
DIRECT
LncBasev2
AC009948.5
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442036
Biotype: antisense
Gene id: ENSG00000223960
Gene Name: AC009948.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:178418667-178418695
exon
HITS-CLIP
DIRECT
LncBasev2
AC011737.2
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431098
Biotype: processed_pseudogene
Gene id: ENSG00000204196
Gene Name: AC011737.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:203191247-203191275
exon
HITS-CLIP
DIRECT
LncBasev2
AC034220.3
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000621103
Biotype: antisense
Gene id: ENSG00000233006
Gene Name: AC034220.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132334918-132334946
exon
HITS-CLIP
DIRECT
LncBasev2
AC098973.1
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000432163
Biotype: lincRNA
Gene id: ENSG00000229243
Gene Name: AC098973.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:27831993-27832021
exon
HITS-CLIP
DIRECT
LncBasev2
AC114755.3
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000453101
Biotype: processed_pseudogene
Gene id: ENSG00000227513
Gene Name: AC114755.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106345406-106345434
exon
HITS-CLIP
DIRECT
LncBasev2
2:106345406-106345434
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106345406-106345434
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106345406-106345434
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948464-30948492
exon
HITS-CLIP
DIRECT
LncBasev2
ADIRF-AS1
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 10
Transcript: ENST00000609170
Biotype: retained_intron
Gene id: ENSG00000272734
Gene Name: ADIRF-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:86966448-86966476
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271547-41271575
exon
HITS-CLIP
DIRECT
LncBasev2
ALDH7A1P1
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000510973
Biotype: processed_pseudogene
Gene id: ENSG00000251400
Gene Name: ALDH7A1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:77290408-77290436
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:23692357-23692385
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107058-116107086
exon
HITS-CLIP
DIRECT
LncBasev2
BRD2-IT1
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415875
Biotype: sense_intronic
Gene id: ENSG00000223837
Gene Name: BRD2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:32970877-32970905
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
6:32970877-32970905
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96090924-96090974
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207815083-207815120
exon
HITS-CLIP
DIRECT
LncBasev2
CHKB-CPT1B
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 22
Transcript: NR_027928.2
Biotype: sense
Gene id: NR_027928.2 (gene)
Gene Name: CHKB-CPT1B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:50576840-50576868
exon
HITS-CLIP
DIRECT
LncBasev2
CKMT2-AS1
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000512287
Biotype: antisense
Gene id: ENSG00000247572
Gene Name: CKMT2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:81236018-81236046
exon
HITS-CLIP
DIRECT
LncBasev2
CLEC2D
hsa-miR-193b-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000396690
Biotype: processed_pseudogene
Gene id: ENSG00000213443
Gene Name: CLEC2D
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
12:9695681-9695709
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-193b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-193b-3p
Sequence: aacuggcccucaaagucccgcu
MirBase ID: MIMAT0002819
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:478159-478187
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: