Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-193b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ACVR2B-AS1
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000441531
Biotype: antisense
Gene id: ENSG00000229589
Gene Name: ACVR2B-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:38451864-38451892
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140520291-140520319
exon
PAR-CLIP
DIRECT
LncBasev2
CTB-36O1.7
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000501056
Biotype: processed_pseudogene
Gene id: ENSG00000244921
Gene Name: CTB-36O1.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
5:134924022-134924050
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P4
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000359165
Biotype: processed_pseudogene
Gene id: ENSG00000245205
Gene Name: EEF1A1P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:19457079-19457107
exon
HITS-CLIP
DIRECT
LncBasev2
ERVK3-1
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000590505
Biotype: retained_intron
Gene id: ENSG00000142396
Gene Name: ERVK3-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58312392-58312420
exon
HITS-CLIP
DIRECT
LncBasev2
H19
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:1995715-1995743
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36047514-36047542
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00963
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000419300
Biotype: lincRNA
Gene id: ENSG00000204054
Gene Name: LINC00963
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:129508201-129508229
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01355
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000566551
Biotype: lincRNA
Gene id: ENSG00000261326
Gene Name: LINC01355
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:23285417-23285445
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65505542-65505570
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65505542-65505570
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505542-65505570
exon
HITS-CLIP
DIRECT
LncBasev2
MRPS31P4
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000509685
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000250299
Gene Name: MRPS31P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:52637343-52637371
exon
HITS-CLIP
DIRECT
LncBasev2
MTND4P12
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000498999
Biotype: processed_pseudogene
Gene id: ENSG00000247627
Gene Name: MTND4P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
5:134927280-134927308
exon
HITS-CLIP
DIRECT
LncBasev2
5:134927119-134927147
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65445048-65445076
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431044-65431072
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431044-65431072
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65431044-65431072
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443681-65443709
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437310-65437338
exon
HITS-CLIP
DIRECT
LncBasev2
NUDT16P1
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000499077
Biotype: processed_transcript
Gene id: ENSG00000246082
Gene Name: NUDT16P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:131363747-131363775
exon
HITS-CLIP
DIRECT
LncBasev2
PAXIP1-AS2
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_024476.1
Biotype: antisense
Gene id: NR_024476.1 (gene)
Gene Name: PAXIP1-AS2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:154944450-154944478
exon
PAR-CLIP
DIRECT
LncBasev2
PAXIP1OS
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000449486
Biotype: antisense
Gene id: ENSG00000214106
Gene Name: PAXIP1OS
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:154944450-154944478
exon
PAR-CLIP
DIRECT
LncBasev2
PIN1P1
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000412108
Biotype: processed_transcript
Gene id: ENSG00000229359
Gene Name: PIN1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:69919422-69919450
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:69919422-69919450
exon
PAR-CLIP
DIRECT
LncBasev2
PKI55
hsa-miR-193b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000562038
Biotype: lincRNA
Gene id: ENSG00000260804
Gene Name: PKI55
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:216220148-216220176
exon
HITS-CLIP
DIRECT
LncBasev2
PPIAP29
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000414949
Biotype: processed_pseudogene
Gene id: ENSG00000214975
Gene Name: PPIAP29
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
6:24976403-24976431
exon
HITS-CLIP
DIRECT
LncBasev2
RGS17P1
hsa-miR-193b-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000423358
Biotype: processed_pseudogene
Gene id: ENSG00000229473
Gene Name: RGS17P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-193b-5p
Sequence: cgggguuuugagggcgagauga
MirBase ID: MIMAT0004767
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:40993115-40993143
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: