Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-197-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-197-3p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:51984135-51984163
exon
HITS-CLIP
DIRECT
LncBasev2
AC012531.25
hsa-miR-197-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562848
Biotype: lincRNA
Gene id: ENSG00000260597
Gene Name: AC012531.25
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:54022030-54022058
exon
HITS-CLIP
DIRECT
LncBasev2
AC019048.1
hsa-miR-197-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000428379
Biotype: antisense
Gene id: ENSG00000223884
Gene Name: AC019048.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:7077750-7077778
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP11
hsa-miR-197-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000436287
Biotype: processed_pseudogene
Gene id: ENSG00000188460
Gene Name: ACTBP11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:223864715-223864743
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
1:223864715-223864743
exon
HITS-CLIP
DIRECT
LncBasev2
ADAMTS7P4
hsa-miR-197-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000561209
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000218052
Gene Name: ADAMTS7P4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
15:85259950-85259978
exon
HITS-CLIP
DIRECT
LncBasev2
AGAP1-IT1
hsa-miR-197-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000440498
Biotype: sense_intronic
Gene id: ENSG00000235529
Gene Name: AGAP1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:235507317-235507345
exon
HITS-CLIP
DIRECT
LncBasev2
AP000320.7
hsa-miR-197-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000362077
Biotype: processed_transcript
Gene id: ENSG00000272657
Gene Name: AP000320.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:34125399-34125427
exon
HITS-CLIP
DIRECT
LncBasev2
21:34125399-34125427
exon
HITS-CLIP
DIRECT
LncBasev2
ASTN2-AS1
hsa-miR-197-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000418250
Biotype: antisense
Gene id: ENSG00000229105
Gene Name: ASTN2-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
9:116551021-116551049
exon
HITS-CLIP
DIRECT
LncBasev2
BAIAP2-AS1
hsa-miR-197-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000577066
Biotype: lincRNA
Gene id: ENSG00000226137
Gene Name: BAIAP2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:81034373-81034401
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-197-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:7882781-7882809
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-197-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140520512-140520540
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140520421-140520449
exon
HITS-CLIP
DIRECT
LncBasev2
CSPG4P11
hsa-miR-197-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560634
Biotype: unprocessed_pseudogene
Gene id: ENSG00000259726
Gene Name: CSPG4P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
15:84189880-84189908
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-197-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149496681-149496709
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
5:149496681-149496709
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-235G5.2
hsa-miR-197-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513990
Biotype: processed_pseudogene
Gene id: ENSG00000251342
Gene Name: CTC-235G5.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:76079316-76079344
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-197-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:48481224-48481252
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479731-48479759
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-197-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57306625-57306653
exon
PAR-CLIP
DIRECT
LncBasev2
CTC-559E9.4
hsa-miR-197-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000590274
Biotype: lincRNA
Gene id: ENSG00000267581
Gene Name: CTC-559E9.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:19821596-19821624
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.1
hsa-miR-197-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000509301
Biotype: processed_pseudogene
Gene id: ENSG00000250645
Gene Name: CTD-2228K2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:418874-418909
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-197-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606319
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:476163-476191
exon
HITS-CLIP
DIRECT
LncBasev2
5:476163-476191
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2534I21.9
hsa-miR-197-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000593177
Biotype: lincRNA
Gene id: ENSG00000267788
Gene Name: CTD-2534I21.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-197-3p
Sequence: uucaccaccuucuccacccagc
MirBase ID: MIMAT0000227
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:44982549-44982577
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: