Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-197-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AGAP2-AS1
hsa-miR-197-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542466
Biotype: antisense
Gene id: ENSG00000255737
Gene Name: AGAP2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:57727267-57727295
exon
HITS-CLIP
DIRECT
LncBasev2
CELP
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000411440
Biotype: processed_transcript
Gene id: ENSG00000170827
Gene Name: CELP
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:133086287-133086315
exon
HITS-CLIP
DIRECT
LncBasev2
LOC646762
hsa-miR-197-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_024278.1
Biotype: lincRNA
Gene id: NR_024278.1 (gene)
Gene Name: LOC646762
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:29648622-29648650
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-197-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100831486-100831514
exon
HITS-CLIP
DIRECT
LncBasev2
MEG3
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: 14
Transcript: NR_046467.1
Biotype: lincRNA
Gene id: NR_046467.1 (gene)
Gene Name: MEG3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100831486-100831514
exon
HITS-CLIP
DIRECT
LncBasev2
RALGAPA1P
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000443361
Biotype: processed_pseudogene
Gene id: ENSG00000229419
Gene Name: RALGAPA1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:105526128-105526156
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-115H13.1
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000620503
Biotype: sense_intronic
Gene id: ENSG00000273906
Gene Name: RP11-115H13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:6919361-6919389
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-212P7.1
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000393266
Biotype: processed_pseudogene
Gene id: ENSG00000213280
Gene Name: RP11-212P7.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:128570402-128570430
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-408P14.1
hsa-miR-197-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000466377
Biotype: processed_pseudogene
Gene id: ENSG00000243199
Gene Name: RP11-408P14.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:65573744-65573772
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-485G4.2
hsa-miR-197-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000608374
Biotype: lincRNA
Gene id: ENSG00000272565
Gene Name: RP11-485G4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:142161580-142161608
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-498C9.15
hsa-miR-197-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000582866
Biotype: lincRNA
Gene id: ENSG00000263731
Gene Name: RP11-498C9.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-197-5p
Sequence: cggguagagagggcagugggagg
MirBase ID: MIMAT0022691
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:81880168-81880196
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: