Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-200a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC083843.1
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000568248
Biotype: lincRNA
Gene id: ENSG00000259820
Gene Name: AC083843.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:134794909-134794937
exon
HITS-CLIP
DIRECT
LncBasev2
AC090627.1
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000421610
Biotype: antisense
Gene id: ENSG00000235300
Gene Name: AC090627.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:48294347-48294375
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532891-62532919
exon
HITS-CLIP
DIRECT
LncBasev2
2:62532859-62532887
exon
HITS-CLIP
DIRECT
LncBasev2
AHCTF1P1
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420969
Biotype: processed_pseudogene
Gene id: ENSG00000226121
Gene Name: AHCTF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161506538-161506566
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107989-116108017
exon
HITS-CLIP
DIRECT
LncBasev2
ASB16-AS1
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000585457
Biotype: antisense
Gene id: ENSG00000267080
Gene Name: ASB16-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:44177615-44177643
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646478-116646506
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527308-140527336
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P6
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000421246
Biotype: processed_pseudogene
Gene id: ENSG00000237350
Gene Name: CDC42P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:22727478-22727506
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:28788190-28788218
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149502309-149502337
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-459F4.3
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000590628
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:27793571-27793599
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24170994-24171022
exon
HITS-CLIP
DIRECT
LncBasev2
DNM3OS
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 1
Transcript: NR_038397.2
Biotype: antisense
Gene id: NR_038397.2 (gene)
Gene Name: DNM3OS
UCSC graphic: -
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:172144293-172144321
exon
HITS-CLIP
DIRECT
LncBasev2
EIF3FP3
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434851
Biotype: processed_pseudogene
Gene id: ENSG00000233426
Gene Name: EIF3FP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58252284-58252312
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:14944316-14944344
exon
HITS-CLIP
DIRECT
LncBasev2
GS1-358P8.4
hsa-miR-200a-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000568479
Biotype: sense_overlapping
Gene id: ENSG00000260822
Gene Name: GS1-358P8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24547035-24547063
exon
HITS-CLIP
DIRECT
LncBasev2
X:24546614-24546642
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426882
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:30292032-30292060
exon
HITS-CLIP
DIRECT
LncBasev2
HCP5
hsa-miR-200a-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000414046
Biotype: sense_overlapping
Gene id: ENSG00000206337
Gene Name: HCP5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:31465766-31465794
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPKP4
hsa-miR-200a-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000485383
Biotype: processed_pseudogene
Gene id: ENSG00000243547
Gene Name: HNRNPKP4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-3p
Sequence: uaacacugucugguaacgaugu
MirBase ID: MIMAT0000682
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:96349754-96349782
exon
HITS-CLIP
DIRECT
LncBasev2
3:96349754-96349782
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:96350892-96350920
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
3:96349754-96349782
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: