Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-200a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC016739.2
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201169-176201197
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:176201169-176201197
exon
HITS-CLIP
DIRECT
LncBasev2
AC020983.5
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000417063
Biotype: processed_pseudogene
Gene id: ENSG00000243099
Gene Name: AC020983.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:138689102-138689130
exon
HITS-CLIP
DIRECT
LncBasev2
ACTG1P14
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000446382
Biotype: processed_pseudogene
Gene id: ENSG00000230581
Gene Name: ACTG1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:6834783-6834811
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC75P1
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000469247
Biotype: processed_pseudogene
Gene id: ENSG00000182921
Gene Name: CCDC75P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:73182661-73182689
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-459M5.2
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506875
Biotype: antisense
Gene id: ENSG00000251187
Gene Name: CTC-459M5.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:112204630-112204658
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.1
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000509301
Biotype: processed_pseudogene
Gene id: ENSG00000250645
Gene Name: CTD-2228K2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:418752-418780
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:478147-478175
exon
HITS-CLIP
DIRECT
LncBasev2
5:478147-478175
exon
HITS-CLIP
DIRECT
LncBasev2
DDX55P1
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000603334
Biotype: processed_pseudogene
Gene id: ENSG00000270863
Gene Name: DDX55P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:11513218-11513246
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360630-55360658
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P33
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000554413
Biotype: processed_pseudogene
Gene id: ENSG00000258846
Gene Name: EEF1A1P33
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:96901471-96901499
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_045026.1
Biotype: lincRNA
Gene id: NR_045026.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439634-16439662
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16439634-16439662
exon
HITS-CLIP
DIRECT
LncBasev2
FTLP3
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000427242
Biotype: processed_pseudogene
Gene id: ENSG00000226608
Gene Name: FTLP3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:4024323-4024351
exon
HITS-CLIP
DIRECT
LncBasev2
HMGB1P5
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000451497
Biotype: processed_transcript
Gene id: ENSG00000132967
Gene Name: HMGB1P5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:22382418-22382446
exon
HITS-CLIP
DIRECT
LncBasev2
HSP90AB2P
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000507090
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000205940
Gene Name: HSP90AB2P
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
4:13337206-13337234
exon
HITS-CLIP
DIRECT
LncBasev2
HSPD1P1
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503199
Biotype: processed_pseudogene
Gene id: ENSG00000213430
Gene Name: HSPD1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:21883571-21883599
exon
HITS-CLIP
DIRECT
LncBasev2
HSPD1P6
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000388967
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000230067
Gene Name: HSPD1P6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:36768601-36768629
exon
HITS-CLIP
DIRECT
LncBasev2
IPO7P2
hsa-miR-200a-5p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000451446
Biotype: processed_pseudogene
Gene id: ENSG00000225674
Gene Name: IPO7P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:24123508-24123536
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00384
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000437721
Biotype: lincRNA
Gene id: ENSG00000232117
Gene Name: LINC00384
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
13:30158168-30158196
exon
HITS-CLIP
DIRECT
LncBasev2
13:30158168-30158196
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00426
hsa-miR-200a-5p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000447147
Biotype: lincRNA
Gene id: ENSG00000238121
Gene Name: LINC00426
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200a-5p
Sequence: caucuuaccggacagugcugga
MirBase ID: MIMAT0001620
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
13:30373871-30373899
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: