Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-21-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000120.7
hsa-miR-21-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200235-92200263
exon
PAR-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195554905-195554933
exon
HITS-CLIP
DIRECT
LncBasev2
AC092638.2
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000441105
Biotype: processed_pseudogene
Gene id: ENSG00000235218
Gene Name: AC092638.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:193277056-193277084
exon
HITS-CLIP
DIRECT
LncBasev2
AC099850.1
hsa-miR-21-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000451775
Biotype: antisense
Gene id: ENSG00000224738
Gene Name: AC099850.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:59107336-59107364
exon
HITS-CLIP
DIRECT
LncBasev2
AC156455.1
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000423999
Biotype: lincRNA
Gene id: ENSG00000256546
Gene Name: AC156455.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:122065469-122065497
exon
HITS-CLIP
DIRECT
LncBasev2
CASC2
hsa-miR-21-5p
qP RP O Bi

Gene Details
Chromosome: 10
Transcript: ENST00000435944
Biotype: antisense
Gene id: ENSG00000177640
Gene Name: CASC2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Brain
U87
qP RP O Bi
Tested Cell Line: U87
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
-
exon
qPCR
INDIRECT
LncBasev2
-
exon
Luciferase Reporter Assay
DIRECT
LncBasev2
-
exon
qPCR
INDIRECT
LncBasev2
-
exon
Other
INDIRECT
LncBasev2
-
exon
Biotin-qPCR
INDIRECT
LncBasev2
-
exon
Biotin-qPCR
INDIRECT
LncBasev2
-
exon
Other
INDIRECT
LncBasev2
CASC7
hsa-miR-21-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:140528786-140528814
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528786-140528814
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528786-140528814
exon
HITS-CLIP
DIRECT
LncBasev2
CCT8P1
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000413611
Biotype: processed_pseudogene
Gene id: ENSG00000226015
Gene Name: CCT8P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147203592-147203620
exon
HITS-CLIP
DIRECT
LncBasev2
CENPBD1P1
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000493504
Biotype: processed_transcript
Gene id: ENSG00000213753
Gene Name: CENPBD1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58583717-58583745
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-21-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29144555-29144583
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-315H11.2
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000619486
Biotype: sense_intronic
Gene id: ENSG00000274080
Gene Name: CTA-315H11.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:73610298-73610326
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-131B5.5
hsa-miR-21-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607850
Biotype: retained_intron
Gene id: ENSG00000254363
Gene Name: CTB-131B5.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:140166773-140166801
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-13L3.1
hsa-miR-21-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000480135
Biotype: processed_transcript
Gene id: ENSG00000273299
Gene Name: CTB-13L3.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:90405543-90405571
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:90405543-90405571
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57306030-57306058
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57306030-57306058
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:57306030-57306058
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2102P23.1
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000536597
Biotype: processed_pseudogene
Gene id: ENSG00000255875
Gene Name: CTD-2102P23.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:52810172-52810200
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2240J17.3
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000612811
Biotype: lincRNA
Gene id: ENSG00000278448
Gene Name: CTD-2240J17.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:81393597-81393625
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2311M21.2
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000562009
Biotype: processed_transcript
Gene id: ENSG00000260266
Gene Name: CTD-2311M21.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:74364167-74364195
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2554C21.1
hsa-miR-21-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587765
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267422
Gene Name: CTD-2554C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37792153-37792181
exon
HITS-CLIP
DIRECT
LncBasev2
19:37792153-37792181
exon
HITS-CLIP
DIRECT
LncBasev2
DYX1C1-CCPG1
hsa-miR-21-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:55360459-55360487
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-21-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441907-16441935
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:16441907-16441935
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: