Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-221-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000120.7
hsa-miR-221-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200094-92200122
exon
HITS-CLIP
DIRECT
LncBasev2
AC002064.5
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445784
Biotype: lincRNA
Gene id: ENSG00000225498
Gene Name: AC002064.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:90312494-90312522
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39599570-39599598
exon
HITS-CLIP
DIRECT
LncBasev2
AC010095.6
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443543
Biotype: processed_pseudogene
Gene id: ENSG00000233648
Gene Name: AC010095.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:108694819-108694847
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258622-20258650
exon
HITS-CLIP
DIRECT
LncBasev2
AC084082.3
hsa-miR-221-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113377-66113405
exon
HITS-CLIP
DIRECT
LncBasev2
8:66113377-66113405
exon
HITS-CLIP
DIRECT
LncBasev2
8:66113377-66113405
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113377-66113405
exon
PAR-CLIP
DIRECT
LncBasev2
AF131215.9
hsa-miR-221-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000602575
Biotype: sense_intronic
Gene id: ENSG00000269918
Gene Name: AF131215.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11106063-11106091
exon
HITS-CLIP
DIRECT
LncBasev2
AP000357.4
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000409926
Biotype: processed_pseudogene
Gene id: ENSG00000224334
Gene Name: AP000357.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:24687311-24687339
exon
HITS-CLIP
DIRECT
LncBasev2
AP000692.9
hsa-miR-221-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000397184
Biotype: sense_overlapping
Gene id: ENSG00000228107
Gene Name: AP000692.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:36360758-36360786
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646215-116646243
exon
HITS-CLIP
DIRECT
LncBasev2
CACNA1C-IT3
hsa-miR-221-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542680
Biotype: sense_intronic
Gene id: ENSG00000256721
Gene Name: CACNA1C-IT3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:2288770-2288798
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-221-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526887-140526915
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526598-140526626
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521052-140521080
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140521052-140521080
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524887-140524915
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526598-140526626
exon
HITS-CLIP
DIRECT
LncBasev2
CCNYL2
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000483242
Biotype: processed_transcript
Gene id: ENSG00000182632
Gene Name: CCNYL2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:42408161-42408189
exon
HITS-CLIP
DIRECT
LncBasev2
CCT6P3
hsa-miR-221-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000419314
Biotype: retained_intron
Gene id: ENSG00000234585
Gene Name: CCT6P3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:65069211-65069239
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-221-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28788806-28788834
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-152G17.6
hsa-miR-221-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000607968
Biotype: antisense
Gene id: ENSG00000272918
Gene Name: CTB-152G17.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:105104137-105104165
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-78F1.1
hsa-miR-221-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000522956
Biotype: antisense
Gene id: ENSG00000254187
Gene Name: CTB-78F1.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:167653741-167653769
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-221-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149504037-149504065
exon
HITS-CLIP
DIRECT
LncBasev2
5:149498819-149498847
exon
HITS-CLIP
DIRECT
LncBasev2
5:149503605-149503633
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149498819-149498847
exon
HITS-CLIP
DIRECT
LncBasev2
5:149496660-149496688
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2199O4.3
hsa-miR-221-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000566945
Biotype: lincRNA
Gene id: ENSG00000260515
Gene Name: CTD-2199O4.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:10195690-10195718
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-221-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-221-3p
Sequence: agcuacauugucugcuggguuuc
MirBase ID: MIMAT0000278
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479822-479850
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: