Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-221-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC009506.1
hsa-miR-221-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000418474
Biotype: antisense
Gene id: ENSG00000224152
Gene Name: AC009506.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:159615789-159615817
exon
HITS-CLIP
DIRECT
LncBasev2
AC027601.1
hsa-miR-221-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000575922
Biotype: antisense
Gene id: ENSG00000260005
Gene Name: AC027601.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:81233575-81233603
exon
HITS-CLIP
DIRECT
LncBasev2
AC083873.4
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000421179
Biotype: processed_pseudogene
Gene id: ENSG00000237821
Gene Name: AC083873.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:133169668-133169696
exon
HITS-CLIP
DIRECT
LncBasev2
AC108004.2
hsa-miR-221-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000576171
Biotype: lincRNA
Gene id: ENSG00000273172
Gene Name: AC108004.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:184188-184216
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-221-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948464-30948492
exon
HITS-CLIP
DIRECT
LncBasev2
AGAP2-AS1
hsa-miR-221-5p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000542466
Biotype: antisense
Gene id: ENSG00000255737
Gene Name: AGAP2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:57727251-57727279
exon
HITS-CLIP
DIRECT
LncBasev2
AKIRIN1P2
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000440655
Biotype: processed_pseudogene
Gene id: ENSG00000228125
Gene Name: AKIRIN1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:68133197-68133225
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23692441-23692469
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-221-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207810510-207810538
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207804356-207804384
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-221-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524002-140524030
exon
HITS-CLIP
DIRECT
LncBasev2
CROCCP1
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000426910
Biotype: processed_pseudogene
Gene id: ENSG00000225769
Gene Name: CROCCP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
X:135433378-135433406
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-204B4.2
hsa-miR-221-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000564464
Biotype: antisense
Gene id: ENSG00000259891
Gene Name: CTA-204B4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140507311-140507339
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-134H23.3
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562618
Biotype: processed_transcript
Gene id: ENSG00000260908
Gene Name: CTB-134H23.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
16:29107526-29107554
exon
HITS-CLIP
DIRECT
LncBasev2
16:29107526-29107554
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-221-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:48479750-48479778
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-575D19.1
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000522551
Biotype: processed_pseudogene
Gene id: ENSG00000233913
Gene Name: CTC-575D19.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Umbilical vein
HUVEC
IP
Tested Cell Line: HUVEC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:168616674-168616702
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-221-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607286
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:477222-477250
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-221-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:478062-478090
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-221-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:478727-478755
exon
HITS-CLIP
DIRECT
LncBasev2
5:478475-478503
exon
HITS-CLIP
DIRECT
LncBasev2
5:478507-478535
exon
HITS-CLIP
DIRECT
LncBasev2
5:478882-478910
exon
HITS-CLIP
DIRECT
LncBasev2
5:479260-479288
exon
HITS-CLIP
DIRECT
LncBasev2
5:479185-479213
exon
HITS-CLIP
DIRECT
LncBasev2
5:478475-478503
exon
HITS-CLIP
DIRECT
LncBasev2
5:478727-478755
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2517M22.17
hsa-miR-221-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000580385
Biotype: antisense
Gene id: ENSG00000265393
Gene Name: CTD-2517M22.17
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
8:144512811-144512839
exon
HITS-CLIP
DIRECT
LncBasev2
8:144512722-144512750
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2540L5.6
hsa-miR-221-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000500016
Biotype: lincRNA
Gene id: ENSG00000245466
Gene Name: CTD-2540L5.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Skeletal Muscle Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-221-5p
Sequence: accuggcauacaauguagauuu
MirBase ID: MIMAT0004568
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:70641006-70641034
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: