Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-24-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-24-3p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989051-51989079
exon
HITS-CLIP
DIRECT
LncBasev2
3:51989051-51989079
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51989051-51989079
exon
HITS-CLIP
DIRECT
LncBasev2
AC000120.7
hsa-miR-24-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200423-92200451
exon
HITS-CLIP
DIRECT
LncBasev2
AC002075.4
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000425207
Biotype: processed_pseudogene
Gene id: ENSG00000237729
Gene Name: AC002075.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:93669811-93669839
exon
HITS-CLIP
DIRECT
LncBasev2
AC003991.3
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000591739
Biotype: antisense
Gene id: ENSG00000228113
Gene Name: AC003991.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:88232156-88232184
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-24-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000355837
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30560924-30560952
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-24-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000584108
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30573593-30573621
exon
HITS-CLIP
DIRECT
LncBasev2
AC009237.8
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442128
Biotype: processed_transcript
Gene id: ENSG00000229689
Gene Name: AC009237.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:95529169-95529197
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-24-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000554133
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92885362-92885390
exon
HITS-CLIP
DIRECT
LncBasev2
AC068491.3
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449539
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000223973
Gene Name: AC068491.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:111384658-111384686
exon
HITS-CLIP
DIRECT
LncBasev2
AC093838.4
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000438378
Biotype: processed_transcript
Gene id: ENSG00000152117
Gene Name: AC093838.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131520977-131521005
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-miR-24-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30948456-30948484
exon
HITS-CLIP
DIRECT
LncBasev2
AC156455.1
hsa-miR-24-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000538790
Biotype: lincRNA
Gene id: ENSG00000256546
Gene Name: AC156455.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:122068392-122068420
exon
HITS-CLIP
DIRECT
LncBasev2
ADAMTSL4-AS1
hsa-miR-24-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000615012
Biotype: retained_intron
Gene id: ENSG00000203804
Gene Name: ADAMTSL4-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:150561481-150561509
exon
HITS-CLIP
DIRECT
LncBasev2
ADAMTSL4-AS1
hsa-miR-24-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000617352
Biotype: antisense
Gene id: ENSG00000203804
Gene Name: ADAMTSL4-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:150573682-150573710
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.2
hsa-miR-24-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000530248
Biotype: sense_intronic
Gene id: ENSG00000255310
Gene Name: AF131215.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11108650-11108678
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41270878-41270906
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-24-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107061-116107089
exon
HITS-CLIP
DIRECT
LncBasev2
BACE2-IT1
hsa-miR-24-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000433378
Biotype: antisense
Gene id: ENSG00000224388
Gene Name: BACE2-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
21:41180268-41180296
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-24-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7883163-7883191
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7883163-7883191
exon
HITS-CLIP
DIRECT
LncBasev2
C21orf67
hsa-miR-24-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000397841
Biotype: lincRNA
Gene id: ENSG00000183250
Gene Name: C21orf67
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-24-3p
Sequence: uggcucaguucagcaggaacag
MirBase ID: MIMAT0000080
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
21:44933821-44933849
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: