Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-26a-2-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTD-2287O16.1
hsa-miR-26a-2-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000469891
Biotype: processed_pseudogene
Gene id: ENSG00000185641
Gene Name: CTD-2287O16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:116051905-116051933
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65503488-65503516
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503488-65503516
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505058-65505086
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501110-65501138
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
11:65503488-65503516
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501110-65501138
exon
HITS-CLIP
DIRECT
LncBasev2
MPRIPP1
hsa-miR-26a-2-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000452433
Biotype: processed_pseudogene
Gene id: ENSG00000214820
Gene Name: MPRIPP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:44580297-44580325
exon
HITS-CLIP
DIRECT
LncBasev2
MTHFS
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000611007
Biotype: lincRNA
Gene id: ENSG00000261229
Gene Name: MTHFS
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:79889185-79889213
exon
PAR-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65430018-65430046
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-153M3.1
hsa-miR-26a-2-3p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000547203
Biotype: processed_pseudogene
Gene id: ENSG00000257576
Gene Name: RP11-153M3.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:56511843-56511871
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-175K6.1
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499583
Biotype: lincRNA
Gene id: ENSG00000245812
Gene Name: RP11-175K6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCL35
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:159117140-159117168
exon
PAR-CLIP
DIRECT
LncBasev2
RP11-707M3.3
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000606067
Biotype: antisense
Gene id: ENSG00000272155
Gene Name: RP11-707M3.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:65714628-65714656
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_003181
hsa-miR-26a-2-3p
IP

Gene Details
Chromosome: chr3
Transcript: TCONS_00007196
Biotype: transcript isomorph
Gene id: XLOC_003181
Gene Name: XLOC_003181
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
chr3:96618158-96618186
exon
HITS-CLIP
DIRECT
LncBasev2
ZFAS1
hsa-miR-26a-2-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000450535
Biotype: antisense
Gene id: ENSG00000177410
Gene Name: ZFAS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-26a-2-3p
Sequence: ccuauucuugauuacuuguuuc
MirBase ID: MIMAT0004681
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:49289060-49289088
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: