Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-26a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000120.7
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200014-92200042
exon
HITS-CLIP
DIRECT
LncBasev2
AC002310.12
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000457283
Biotype: antisense
Gene id: ENSG00000235560
Gene Name: AC002310.12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:30537098-30537126
exon
HITS-CLIP
DIRECT
LncBasev2
AC005618.6
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606901
Biotype: lincRNA
Gene id: ENSG00000272070
Gene Name: AC005618.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:141327462-141327490
exon
HITS-CLIP
DIRECT
LncBasev2
AC005682.5
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000415611
Biotype: lincRNA
Gene id: ENSG00000228649
Gene Name: AC005682.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:22856999-22857027
exon
HITS-CLIP
DIRECT
LncBasev2
AC005754.8
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606030
Biotype: lincRNA
Gene id: ENSG00000272108
Gene Name: AC005754.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:141120066-141120094
exon
HITS-CLIP
DIRECT
LncBasev2
AC006024.4
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000428251
Biotype: processed_pseudogene
Gene id: ENSG00000218305
Gene Name: AC006024.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:48925265-48925293
exon
HITS-CLIP
DIRECT
LncBasev2
AC008697.1
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000515337
Biotype: lincRNA
Gene id: ENSG00000249738
Gene Name: AC008697.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:159362464-159362492
exon
HITS-CLIP
DIRECT
LncBasev2
AC010522.1
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000594588
Biotype: processed_pseudogene
Gene id: ENSG00000269304
Gene Name: AC010522.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57826683-57826711
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557682
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92899409-92899437
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000554133
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92885446-92885474
exon
HITS-CLIP
DIRECT
LncBasev2
AC024560.3
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000414207
Biotype: processed_transcript
Gene id: ENSG00000214135
Gene Name: AC024560.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:197613245-197613273
exon
HITS-CLIP
DIRECT
LncBasev2
AC026271.5
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000447794
Biotype: processed_pseudogene
Gene id: ENSG00000174977
Gene Name: AC026271.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:18650867-18650895
exon
HITS-CLIP
DIRECT
LncBasev2
AC026806.2
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000602211
Biotype: lincRNA
Gene id: ENSG00000268913
Gene Name: AC026806.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:38331965-38331993
exon
HITS-CLIP
DIRECT
LncBasev2
AC068039.4
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416361
Biotype: antisense
Gene id: ENSG00000228389
Gene Name: AC068039.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:171773804-171773832
exon
HITS-CLIP
DIRECT
LncBasev2
AC074117.10
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000447070
Biotype: antisense
Gene id: ENSG00000234072
Gene Name: AC074117.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27357817-27357845
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258931-20258959
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258931-20258959
exon
HITS-CLIP
DIRECT
LncBasev2
AC079776.3
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000450840
Biotype: lincRNA
Gene id: ENSG00000237574
Gene Name: AC079776.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:129945985-129946013
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:6675353-6675381
exon
PAR-CLIP
DIRECT
LncBasev2
AC093642.3
hsa-miR-26a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429456
Biotype: lincRNA
Gene id: ENSG00000237940
Gene Name: AC093642.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
2:241971025-241971053
exon
HITS-CLIP
DIRECT
LncBasev2
ADH5P4
hsa-miR-26a-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000433151
Biotype: processed_pseudogene
Gene id: ENSG00000233859
Gene Name: ADH5P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-26a-5p
Sequence: uucaaguaauccaggauaggcu
MirBase ID: MIMAT0000082
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:65837658-65837686
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: