Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-29a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004967.7
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453589
Biotype: unprocessed_pseudogene
Gene id: ENSG00000243554
Gene Name: AC004967.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:97969018-97969057
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000454922
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30577882-30577910
exon
HITS-CLIP
DIRECT
LncBasev2
7:30577828-30577869
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30577828-30577869
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30577828-30577869
exon
HITS-CLIP
DIRECT
LncBasev2
AC005336.4
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000585431
Biotype: processed_pseudogene
Gene id: ENSG00000267056
Gene Name: AC005336.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:15911518-15911546
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608475-30608503
exon
HITS-CLIP
DIRECT
LncBasev2
AC006548.28
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:16963194-16963222
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159013-30159041
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159013-30159041
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30159013-30159041
exon
HITS-CLIP
DIRECT
LncBasev2
AC007395.4
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000451333
Biotype: processed_pseudogene
Gene id: ENSG00000231386
Gene Name: AC007395.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:70811079-70811107
exon
HITS-CLIP
DIRECT
LncBasev2
AC011737.2
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431098
Biotype: processed_pseudogene
Gene id: ENSG00000204196
Gene Name: AC011737.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:203191229-203191257
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000555227
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92886466-92886494
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92886466-92886494
exon
HITS-CLIP
DIRECT
LncBasev2
AC058791.1
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_034120.1
Biotype: lincRNA
Gene id: NR_034120.1 (gene)
Gene Name: AC058791.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:130882724-130882752
exon
HITS-CLIP
DIRECT
LncBasev2
AC083843.1
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000568248
Biotype: lincRNA
Gene id: ENSG00000259820
Gene Name: AC083843.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:134794909-134794937
exon
HITS-CLIP
DIRECT
LncBasev2
AC093106.5
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000431248
Biotype: processed_pseudogene
Gene id: ENSG00000236281
Gene Name: AC093106.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:131753942-131753970
exon
HITS-CLIP
DIRECT
LncBasev2
AC113331.9
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000428160
Biotype: lincRNA
Gene id: ENSG00000236897
Gene Name: AC113331.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:5107447-5107475
exon
HITS-CLIP
DIRECT
LncBasev2
AC114271.2
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000612689
Biotype: antisense
Gene id: ENSG00000274425
Gene Name: AC114271.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:10333939-10333967
exon
HITS-CLIP
DIRECT
LncBasev2
AL590762.11
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000391782
Biotype: processed_pseudogene
Gene id: ENSG00000213018
Gene Name: AL590762.11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:71420451-71420479
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:71420451-71420479
exon
HITS-CLIP
DIRECT
LncBasev2
AL591704.5
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000447781
Biotype: processed_pseudogene
Gene id: ENSG00000237008
Gene Name: AL591704.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:153379877-153379905
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
1:153379877-153379905
exon
HITS-CLIP
DIRECT
LncBasev2
ANKRD10-IT1
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000426991
Biotype: sense_intronic
Gene id: ENSG00000229152
Gene Name: ANKRD10-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:110894842-110894870
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23692816-23692850
exon
HITS-CLIP
DIRECT
LncBasev2
AP000350.5
hsa-miR-29a-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000609510
Biotype: lincRNA
Gene id: ENSG00000273295
Gene Name: AP000350.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:23902617-23902645
exon
HITS-CLIP
DIRECT
LncBasev2
BANF1P4
hsa-miR-29a-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000420029
Biotype: processed_pseudogene
Gene id: ENSG00000223828
Gene Name: BANF1P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-29a-3p
Sequence: uagcaccaucugaaaucgguua
MirBase ID: MIMAT0000086
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:174756964-174756992
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: