Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-301a-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC006011.4
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442758
Biotype: processed_pseudogene
Gene id: ENSG00000244563
Gene Name: AC006011.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:127847029-127847057
exon
HITS-CLIP
DIRECT
LncBasev2
AC007163.9
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454456
Biotype: unprocessed_pseudogene
Gene id: ENSG00000227736
Gene Name: AC007163.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:201553024-201553052
exon
HITS-CLIP
DIRECT
LncBasev2
AC144450.2
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000366424
Biotype: lincRNA
Gene id: ENSG00000203635
Gene Name: AC144450.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Prostate Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:1621915-1621943
exon
HITS-CLIP
DIRECT
LncBasev2
AFG3L1P
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000437774
Biotype: processed_transcript
Gene id: ENSG00000223959
Gene Name: AFG3L1P
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
16:89996435-89996463
exon
HITS-CLIP
DIRECT
LncBasev2
16:89996494-89996522
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:89995616-89995644
exon
HITS-CLIP
DIRECT
LncBasev2
16:89996494-89996522
exon
HITS-CLIP
DIRECT
LncBasev2
16:89995829-89995857
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:89996494-89996522
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271563-41271591
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:23658161-23658189
exon
HITS-CLIP
DIRECT
LncBasev2
AP000654.5
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605633
Biotype: processed_pseudogene
Gene id: ENSG00000271318
Gene Name: AP000654.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:86821532-86821560
exon
HITS-CLIP
DIRECT
LncBasev2
B3GAT3P1
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000471720
Biotype: processed_pseudogene
Gene id: ENSG00000244009
Gene Name: B3GAT3P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:160453276-160453304
exon
HITS-CLIP
DIRECT
LncBasev2
BX322557.10
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000400362
Biotype: lincRNA
Gene id: ENSG00000215447
Gene Name: BX322557.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:45291696-45291724
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527611-140527639
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521212-140521240
exon
HITS-CLIP
DIRECT
LncBasev2
8:140528578-140528606
exon
HITS-CLIP
DIRECT
LncBasev2
8:140528578-140528606
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521212-140521240
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527611-140527639
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527461-140527489
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521212-140521240
exon
PAR-CLIP
DIRECT
LncBasev2
8:140527461-140527489
exon
PAR-CLIP
DIRECT
LncBasev2
8:140520408-140520436
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:140521212-140521240
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521212-140521240
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527461-140527489
exon
PAR-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140521212-140521240
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528578-140528606
exon
HITS-CLIP
DIRECT
LncBasev2
CCAT1
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000500112
Biotype: lincRNA
Gene id: ENSG00000247844
Gene Name: CCAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:127218841-127218869
exon
HITS-CLIP
DIRECT
LncBasev2
CCT5P2
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 13
Transcript: ENST00000432974
Biotype: processed_pseudogene
Gene id: ENSG00000230584
Gene Name: CCT5P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:78909888-78909916
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P6
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000421246
Biotype: processed_pseudogene
Gene id: ENSG00000237350
Gene Name: CDC42P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:22727471-22727499
exon
HITS-CLIP
DIRECT
LncBasev2
CENPBD1P1
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000493504
Biotype: processed_transcript
Gene id: ENSG00000213753
Gene Name: CENPBD1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:58583712-58583740
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-338M12.2
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513771
Biotype: lincRNA
Gene id: ENSG00000248473
Gene Name: CTC-338M12.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:181191730-181191758
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:181191730-181191758
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-301a-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24171006-24171034
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478048-478076
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:478837-478865
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2574D22.2
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000450909
Biotype: antisense
Gene id: ENSG00000247735
Gene Name: CTD-2574D22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
16:29927057-29927085
exon
HITS-CLIP
DIRECT
LncBasev2
DHRS4-AS1
hsa-miR-301a-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000556379
Biotype: antisense
Gene id: ENSG00000215256
Gene Name: DHRS4-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-3p
Sequence: cagugcaauaguauugucaaagc
MirBase ID: MIMAT0000688
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:23939645-23939673
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: