Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-301a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004453.8
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000487895
Biotype: processed_pseudogene
Gene id: ENSG00000146677
Gene Name: AC004453.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:44468233-44468261
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000355837
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30553358-30553386
exon
HITS-CLIP
DIRECT
LncBasev2
AC012123.1
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 18
Transcript: ENST00000426194
Biotype: antisense
Gene id: ENSG00000228835
Gene Name: AC012123.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
18:32771058-32771086
exon
HITS-CLIP
DIRECT
LncBasev2
AC027601.1
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000575922
Biotype: antisense
Gene id: ENSG00000260005
Gene Name: AC027601.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
17:81229301-81229329
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:195554777-195554805
exon
HITS-CLIP
DIRECT
LncBasev2
AC103564.6
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432853
Biotype: unprocessed_pseudogene
Gene id: ENSG00000232760
Gene Name: AC103564.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131836144-131836172
exon
HITS-CLIP
DIRECT
LncBasev2
AL022237.3
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000446663
Biotype: processed_pseudogene
Gene id: ENSG00000234735
Gene Name: AL022237.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:43092441-43092469
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC1-AS1
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000623970
Biotype: antisense
Gene id: ENSG00000203993
Gene Name: ARRDC1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:137615995-137616023
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7888740-7888768
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646142-116646170
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207811702-207811730
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:207815651-207815679
exon
HITS-CLIP
DIRECT
LncBasev2
CEP57L1P1
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000430943
Biotype: processed_pseudogene
Gene id: ENSG00000224725
Gene Name: CEP57L1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:70389874-70389902
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:29140302-29140330
exon
HITS-CLIP
DIRECT
LncBasev2
CNOT6LP1
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000559681
Biotype: processed_pseudogene
Gene id: ENSG00000230183
Gene Name: CNOT6LP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
15:56006645-56006673
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28788543-28788571
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-445C9.14
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000566814
Biotype: antisense
Gene id: ENSG00000261188
Gene Name: CTA-445C9.14
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:26514371-26514399
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-989H11.1
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000609564
Biotype: lincRNA
Gene id: ENSG00000273366
Gene Name: CTA-989H11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:42278793-42278821
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-50E14.5
hsa-miR-301a-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600255
Biotype: processed_pseudogene
Gene id: ENSG00000269374
Gene Name: CTB-50E14.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:42485595-42485623
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149502297-149502325
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2083E4.6
hsa-miR-301a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000512642
Biotype: antisense
Gene id: ENSG00000248925
Gene Name: CTD-2083E4.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-301a-5p
Sequence: gcucugacuuuauugcacuacu
MirBase ID: MIMAT0022696
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:270152-270180
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: