Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002064.5
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445784
Biotype: lincRNA
Gene id: ENSG00000225498
Gene Name: AC002064.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:90322251-90322279
exon
HITS-CLIP
DIRECT
LncBasev2
AC005017.2
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000482002
Biotype: processed_pseudogene
Gene id: ENSG00000174495
Gene Name: AC005017.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:28279622-28279650
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000579174
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30574678-30574706
exon
HITS-CLIP
DIRECT
LncBasev2
AC005618.6
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606901
Biotype: lincRNA
Gene id: ENSG00000272070
Gene Name: AC005618.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:141326854-141326882
exon
HITS-CLIP
DIRECT
LncBasev2
AC016739.2
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000405359
Biotype: processed_pseudogene
Gene id: ENSG00000218175
Gene Name: AC016739.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:176201109-176201137
exon
HITS-CLIP
DIRECT
LncBasev2
AC017078.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416146
Biotype: processed_pseudogene
Gene id: ENSG00000233829
Gene Name: AC017078.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
AC022431.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000450941
Biotype: processed_pseudogene
Gene id: ENSG00000226221
Gene Name: AC022431.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:56504850-56504878
exon
HITS-CLIP
DIRECT
LncBasev2
AC096772.6
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000343987
Biotype: lincRNA
Gene id: ENSG00000244567
Gene Name: AC096772.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:207821448-207821476
exon
HITS-CLIP
DIRECT
LncBasev2
ACAP2-IT1
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000419899
Biotype: sense_intronic
Gene id: ENSG00000229325
Gene Name: ACAP2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:195282699-195282727
exon
HITS-CLIP
DIRECT
LncBasev2
3:195282399-195282427
exon
HITS-CLIP
DIRECT
LncBasev2
AL132709.8
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000442197
Biotype: lincRNA
Gene id: ENSG00000232018
Gene Name: AL132709.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100966673-100966701
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000610331
Biotype: sense_intronic
Gene id: ENSG00000276334
Gene Name: AL133243.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32523466-32523494
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32529393-32529421
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271762-41271790
exon
HITS-CLIP
DIRECT
LncBasev2
BTF3P10
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000433415
Biotype: processed_pseudogene
Gene id: ENSG00000231120
Gene Name: BTF3P10
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:149978094-149978122
exon
HITS-CLIP
DIRECT
LncBasev2
BTF3P7
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000407097
Biotype: processed_pseudogene
Gene id: ENSG00000219986
Gene Name: BTF3P7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
6:6795206-6795234
exon
HITS-CLIP
DIRECT
LncBasev2
6:6795206-6795234
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140522330-140522358
exon
PAR-CLIP
DIRECT
LncBasev2
8:140528972-140529000
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
8:140522330-140522358
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
8:140528209-140528237
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521059-140521087
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521059-140521087
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140520829-140520857
exon
HITS-CLIP
DIRECT
LncBasev2
8:140521584-140521612
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
CCT8P1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000413611
Biotype: processed_pseudogene
Gene id: ENSG00000226015
Gene Name: CCT8P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:147203880-147203908
exon
HITS-CLIP
DIRECT
LncBasev2
CEBPZ-AS1
hsa-miR-30b-5p
IP

Gene Details
Chromosome: 2
Transcript: NR_037879.1
Biotype: sense
Gene id: NR_037879.1 (gene)
Gene Name: CEBPZ-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:37203412-37203440
exon
HITS-CLIP
DIRECT
LncBasev2
CH17-262A2.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000618815
Biotype: sense_intronic
Gene id: ENSG00000275426
Gene Name: CH17-262A2.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:149920-149948
exon
HITS-CLIP
DIRECT
LncBasev2
CH17-431G21.1
hsa-miR-30b-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000620148
Biotype: unprocessed_pseudogene
Gene id: ENSG00000274487
Gene Name: CH17-431G21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30b-5p
Sequence: uguaaacauccuacacucagcu
MirBase ID: MIMAT0000420
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:38202822-38202850
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: