Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30e-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004951.6
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000447643
Biotype: lincRNA
Gene id: ENSG00000228434
Gene Name: AC004951.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:44005167-44005195
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000434399
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30524401-30524429
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.7
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000419639
Biotype: processed_pseudogene
Gene id: ENSG00000244480
Gene Name: AC005154.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30524401-30524429
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159422-30159450
exon
HITS-CLIP
DIRECT
LncBasev2
AC007041.2
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000438989
Biotype: processed_pseudogene
Gene id: ENSG00000235411
Gene Name: AC007041.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:20240434-20240462
exon
HITS-CLIP
DIRECT
LncBasev2
AC020983.5
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000417063
Biotype: processed_pseudogene
Gene id: ENSG00000243099
Gene Name: AC020983.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:138689099-138689127
exon
HITS-CLIP
DIRECT
LncBasev2
AC022182.2
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000529239
Biotype: processed_pseudogene
Gene id: ENSG00000255397
Gene Name: AC022182.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:60938400-60938428
exon
HITS-CLIP
DIRECT
LncBasev2
AC096664.2
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000393996
Biotype: processed_pseudogene
Gene id: ENSG00000228872
Gene Name: AC096664.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:63717198-63717226
exon
HITS-CLIP
DIRECT
LncBasev2
ADAMTSL4-AS1
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000615012
Biotype: retained_intron
Gene id: ENSG00000203804
Gene Name: ADAMTSL4-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MDAMB231
IP
Tested Cell Line: MDAMB231
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:150560350-150560378
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.9
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000602575
Biotype: sense_intronic
Gene id: ENSG00000269918
Gene Name: AF131215.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11106103-11106131
exon
HITS-CLIP
DIRECT
LncBasev2
AHCTF1P1
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420969
Biotype: processed_pseudogene
Gene id: ENSG00000226121
Gene Name: AHCTF1P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161505725-161505753
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32AP1
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000560832
Biotype: processed_transcript
Gene id: ENSG00000259516
Gene Name: ANP32AP1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:35237358-35237386
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32BP2
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000454525
Biotype: processed_pseudogene
Gene id: ENSG00000231801
Gene Name: ANP32BP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:44651843-44651871
exon
HITS-CLIP
DIRECT
LncBasev2
ARRDC1-AS1
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000623970
Biotype: antisense
Gene id: ENSG00000203993
Gene Name: ARRDC1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:137617677-137617705
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:7882642-7882670
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:7882779-7882807
exon
HITS-CLIP
DIRECT
LncBasev2
BNIP3P1
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000550043
Biotype: processed_transcript
Gene id: ENSG00000197358
Gene Name: BNIP3P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:28264770-28264798
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646085-116646113
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528177-140528205
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
8:140528177-140528205
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140526584-140526612
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528177-140528205
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521381-140521409
exon
PAR-CLIP
DIRECT
LncBasev2
CCAT1
hsa-miR-30e-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000500112
Biotype: lincRNA
Gene id: ENSG00000247844
Gene Name: CCAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
8:127209464-127209492
exon
HITS-CLIP
DIRECT
LncBasev2
CDC42P6
hsa-miR-30e-3p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000421246
Biotype: processed_pseudogene
Gene id: ENSG00000237350
Gene Name: CDC42P6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-3p
Sequence: cuuucagucggauguuuacagc
MirBase ID: MIMAT0000693
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:22727520-22727548
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: