Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-30e-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002064.5
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445784
Biotype: lincRNA
Gene id: ENSG00000225498
Gene Name: AC002064.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
7:90322251-90322279
exon
HITS-CLIP
DIRECT
LncBasev2
AC005017.2
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000482002
Biotype: processed_pseudogene
Gene id: ENSG00000174495
Gene Name: AC005017.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:28279622-28279650
exon
HITS-CLIP
DIRECT
LncBasev2
AC007238.1
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434096
Biotype: processed_pseudogene
Gene id: ENSG00000231043
Gene Name: AC007238.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNAs against HIV-1
Location
Region
Method
Result
Validation Type
Source
2:58461337-58461365
exon
HITS-CLIP
DIRECT
LncBasev2
AC017078.1
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000416146
Biotype: processed_pseudogene
Gene id: ENSG00000233829
Gene Name: AC017078.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
2:46004156-46004184
exon
HITS-CLIP
DIRECT
LncBasev2
AL132709.8
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000442197
Biotype: lincRNA
Gene id: ENSG00000232018
Gene Name: AL132709.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:100966673-100966701
exon
HITS-CLIP
DIRECT
LncBasev2
BTF3P7
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000407097
Biotype: processed_pseudogene
Gene id: ENSG00000219986
Gene Name: BTF3P7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
6:6795206-6795234
exon
HITS-CLIP
DIRECT
LncBasev2
6:6795206-6795234
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
8:140525729-140525757
exon
HITS-CLIP
DIRECT
LncBasev2
8:140522330-140522358
exon
HITS-CLIP
DIRECT
LncBasev2
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
8:140526611-140526639
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528209-140528237
exon
HITS-CLIP
DIRECT
LncBasev2
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140522330-140522358
exon
PAR-CLIP
DIRECT
LncBasev2
8:140528972-140529000
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
8:140521059-140521087
exon
HITS-CLIP
DIRECT
LncBasev2
8:140522330-140522358
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521059-140521087
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521059-140521087
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140528456-140528484
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28787492-28787520
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28786733-28786761
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149498811-149498839
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
5:149496016-149496044
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-429P9.3
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000598112
Biotype: sense_intronic
Gene id: ENSG00000269044
Gene Name: CTC-429P9.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:16634849-16634877
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2587H24.14
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586923
Biotype: retained_intron
Gene id: ENSG00000276570
Gene Name: CTD-2587H24.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:55229780-55229808
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3138B18.5
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000597230
Biotype: antisense
Gene id: ENSG00000268516
Gene Name: CTD-3138B18.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:58259425-58259453
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-3229J4.1
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000564852
Biotype: lincRNA
Gene id: ENSG00000261555
Gene Name: CTD-3229J4.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
16:17826857-17826885
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P17
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 12
Transcript: ENST00000547505
Biotype: processed_pseudogene
Gene id: ENSG00000257907
Gene Name: EEF1A1P17
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:43659998-43660026
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P9
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 4
Transcript: ENST00000514975
Biotype: processed_pseudogene
Gene id: ENSG00000249264
Gene Name: EEF1A1P9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:105485426-105485454
exon
HITS-CLIP
DIRECT
LncBasev2
4:105485426-105485454
exon
HITS-CLIP
DIRECT
LncBasev2
FABP5P7
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000524732
Biotype: processed_pseudogene
Gene id: ENSG00000234964
Gene Name: FABP5P7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: ESC
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:59781451-59781479
exon
PAR-CLIP
DIRECT
LncBasev2
FAM83H-AS1
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000533004
Biotype: lincRNA
Gene id: ENSG00000203499
Gene Name: FAM83H-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:143746258-143746286
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:14943166-14943194
exon
HITS-CLIP
DIRECT
LncBasev2
3:14942829-14942857
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ31306
hsa-miR-30e-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000554360
Biotype: antisense
Gene id: ENSG00000257621
Gene Name: FLJ31306
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:58265691-58265719
exon
PAR-CLIP
DIRECT
LncBasev2
GAPDHP1
hsa-miR-30e-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000452570
Biotype: processed_pseudogene
Gene id: ENSG00000228232
Gene Name: GAPDHP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-30e-5p
Sequence: uguaaacauccuugacuggaag
MirBase ID: MIMAT0000692
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:39788001-39788029
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: