Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3127-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC002480.2
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414116
Biotype: lincRNA
Gene id: ENSG00000238033
Gene Name: AC002480.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:22650619-22650647
exon
HITS-CLIP
DIRECT
LncBasev2
AC019118.4
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454530
Biotype: lincRNA
Gene id: ENSG00000226649
Gene Name: AC019118.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:3157211-3157239
exon
HITS-CLIP
DIRECT
LncBasev2
AC053503.6
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000431827
Biotype: antisense
Gene id: ENSG00000234638
Gene Name: AC053503.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:219426111-219426139
exon
HITS-CLIP
DIRECT
LncBasev2
AC087380.14
hsa-miR-3127-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000411807
Biotype: unprocessed_pseudogene
Gene id: ENSG00000224295
Gene Name: AC087380.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:5518866-5518894
exon
HITS-CLIP
DIRECT
LncBasev2
ACTG1P1
hsa-miR-3127-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000415794
Biotype: processed_pseudogene
Gene id: ENSG00000178631
Gene Name: ACTG1P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
3:139494737-139494765
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-3127-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:23691872-23691900
exon
HITS-CLIP
DIRECT
LncBasev2
22:23690959-23690987
exon
HITS-CLIP
DIRECT
LncBasev2
BRD2-IT1
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000415875
Biotype: sense_intronic
Gene id: ENSG00000223837
Gene Name: BRD2-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:32970851-32970896
exon
HITS-CLIP
DIRECT
LncBasev2
6:32970851-32970896
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
8:140521902-140521930
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:29150644-29150672
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-315H11.2
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000619486
Biotype: sense_intronic
Gene id: ENSG00000274080
Gene Name: CTA-315H11.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
7:73610209-73610237
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48472300-48472328
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000607286
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:475160-475188
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:478300-478328
exon
HITS-CLIP
DIRECT
LncBasev2
5:478676-478704
exon
HITS-CLIP
DIRECT
LncBasev2
5:478300-478328
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2281M20.1
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506769
Biotype: lincRNA
Gene id: ENSG00000250891
Gene Name: CTD-2281M20.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:118561978-118562006
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2349P21.5
hsa-miR-3127-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581019
Biotype: lincRNA
Gene id: ENSG00000263603
Gene Name: CTD-2349P21.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:30730016-30730044
exon
HITS-CLIP
DIRECT
LncBasev2
EI24P1
hsa-miR-3127-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000416584
Biotype: processed_pseudogene
Gene id: ENSG00000236357
Gene Name: EI24P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:176068892-176068920
exon
HITS-CLIP
DIRECT
LncBasev2
EXTL3-AS1
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000501224
Biotype: antisense
Gene id: ENSG00000246339
Gene Name: EXTL3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:28700784-28700812
exon
HITS-CLIP
DIRECT
LncBasev2
FEZF1-AS1
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000424404
Biotype: antisense
Gene id: ENSG00000230316
Gene Name: FEZF1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:122307170-122307198
exon
HITS-CLIP
DIRECT
LncBasev2
FLJ37505
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000536342
Biotype: lincRNA
Gene id: ENSG00000256597
Gene Name: FLJ37505
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:127882889-127882917
exon
HITS-CLIP
DIRECT
LncBasev2
GUSBP11
hsa-miR-3127-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000455485
Biotype: processed_transcript
Gene id: ENSG00000228315
Gene Name: GUSBP11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-3p
Sequence: uccccuucugcaggccugcugg
MirBase ID: MIMAT0019201
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:23691872-23691900
exon
HITS-CLIP
DIRECT
LncBasev2
22:23690959-23690987
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: