Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3127-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005154.6
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000434399
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30524403-30524431
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.7
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000419639
Biotype: processed_pseudogene
Gene id: ENSG00000244480
Gene Name: AC005154.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:30524403-30524431
exon
HITS-CLIP
DIRECT
LncBasev2
AC013267.1
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000458227
Biotype: processed_pseudogene
Gene id: ENSG00000237953
Gene Name: AC013267.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
2:24969122-24969150
exon
HITS-CLIP
DIRECT
LncBasev2
AC017074.1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000439382
Biotype: lincRNA
Gene id: ENSG00000233479
Gene Name: AC017074.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:113672891-113672919
exon
HITS-CLIP
DIRECT
LncBasev2
ACTG1P4
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000425123
Biotype: processed_pseudogene
Gene id: ENSG00000236085
Gene Name: ACTG1P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:103569855-103569883
exon
HITS-CLIP
DIRECT
LncBasev2
CALM2P2
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000428512
Biotype: processed_pseudogene
Gene id: ENSG00000229097
Gene Name: CALM2P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
10:70163858-70163886
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
9:136804689-136804730
exon
HITS-CLIP
DIRECT
LncBasev2
9:136804689-136804730
exon
HITS-CLIP
DIRECT
LncBasev2
9:136804689-136804717
exon
HITS-CLIP
DIRECT
LncBasev2
CRYBB2P1
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000382734
Biotype: processed_transcript
Gene id: ENSG00000100058
Gene Name: CRYBB2P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:25448200-25448228
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:149498628-149498656
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-246B18.8
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601911
Biotype: sense_overlapping
Gene id: ENSG00000268262
Gene Name: CTC-246B18.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:39318331-39318367
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-280C13.1
hsa-miR-3127-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000483777
Biotype: processed_pseudogene
Gene id: ENSG00000253261
Gene Name: CTC-280C13.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:154994382-154994410
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-425O23.2
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000378432
Biotype: sense_intronic
Gene id: ENSG00000205041
Gene Name: CTC-425O23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:40274303-40274331
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:478829-478857
exon
HITS-CLIP
DIRECT
LncBasev2
5:479067-479095
exon
HITS-CLIP
DIRECT
LncBasev2
5:478829-478857
exon
HITS-CLIP
DIRECT
LncBasev2
5:479067-479095
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606319
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:476120-476148
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2562G15.3
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000617588
Biotype: sense_intronic
Gene id: ENSG00000276744
Gene Name: CTD-2562G15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:75453706-75453734
exon
HITS-CLIP
DIRECT
LncBasev2
ERI3-IT1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000414156
Biotype: sense_intronic
Gene id: ENSG00000233602
Gene Name: ERI3-IT1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:44243683-44243711
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_027160.1
Biotype: antisense
Gene id: NR_027160.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:16439606-16439634
exon
HITS-CLIP
DIRECT
LncBasev2
FAM211A-AS1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 17
Transcript: NR_045026.1
Biotype: lincRNA
Gene id: NR_045026.1 (gene)
Gene Name: FAM211A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:16439606-16439634
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
3:14947153-14947181
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-3127-5p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426882
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3127-5p
Sequence: aucagggcuuguggaaugggaag
MirBase ID: MIMAT0014990
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:30291849-30291877
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: