Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3145-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CASC7
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:140520902-140520930
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000602516
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
6:30304245-30304273
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPU-AS1
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000366527
Biotype: antisense
Gene id: ENSG00000188206
Gene Name: HNRNPU-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:244842916-244842944
exon
HITS-CLIP
DIRECT
LncBasev2
1:244842916-244842944
exon
HITS-CLIP
DIRECT
LncBasev2
LINC01006
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000333319
Biotype: lincRNA
Gene id: ENSG00000182648
Gene Name: LINC01006
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:156638614-156638642
exon
HITS-CLIP
DIRECT
LncBasev2
LRRC75A-AS1
hsa-miR-3145-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000491009
Biotype: antisense
Gene id: ENSG00000175061
Gene Name: LRRC75A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:16441223-16441251
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441223-16441251
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441223-16441251
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441223-16441251
exon
HITS-CLIP
DIRECT
LncBasev2
17:16441223-16441251
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:65503243-65503271
exon
HITS-CLIP
DIRECT
LncBasev2
11:65503243-65503271
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501228-65501256
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501963-65501991
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501314-65501342
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501228-65501256
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501963-65501991
exon
HITS-CLIP
DIRECT
LncBasev2
MIR10A
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000548801
Biotype: sense_intronic
Gene id: ENSG00000257178
Gene Name: MIR10A
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:48579958-48579986
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65426233-65426261
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427475-65427503
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443418-65443446
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427475-65427503
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65426233-65426261
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422970-65422998
exon
HITS-CLIP
DIRECT
LncBasev2
PPP4R1L
hsa-miR-3145-3p
-
IP

Gene Details
Chromosome: 20
Transcript: ENST00000497138
Biotype: processed_transcript
Gene id: ENSG00000124224
Gene Name: PPP4R1L
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
20:58231265-58231293
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-145M9.4
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000595265
Biotype: lincRNA
Gene id: ENSG00000269728
Gene Name: RP11-145M9.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:179397560-179397588
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-172H24.4
hsa-miR-3145-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000610494
Biotype: antisense
Gene id: ENSG00000278291
Gene Name: RP11-172H24.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
13:20702432-20702460
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-510I6.2
hsa-miR-3145-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000466718
Biotype: processed_pseudogene
Gene id: ENSG00000213661
Gene Name: RP11-510I6.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:121616287-121616315
exon
HITS-CLIP
DIRECT
LncBasev2
XIST
hsa-miR-3145-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000429829
Biotype: lincRNA
Gene id: ENSG00000229807
Gene Name: XIST
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:73850840-73850868
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851939-73851967
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850840-73850868
exon
HITS-CLIP
DIRECT
LncBasev2
X:73821854-73821882
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850840-73850868
exon
HITS-CLIP
DIRECT
LncBasev2
X:73852169-73852197
exon
HITS-CLIP
DIRECT
LncBasev2
X:73841602-73841630
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824138-73824166
exon
HITS-CLIP
DIRECT
LncBasev2
X:73827818-73827846
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851939-73851967
exon
HITS-CLIP
DIRECT
LncBasev2
X:73824087-73824115
exon
HITS-CLIP
DIRECT
LncBasev2
X:73852169-73852197
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850840-73850868
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851939-73851967
exon
HITS-CLIP
DIRECT
LncBasev2
X:73841602-73841630
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825461-73825489
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851939-73851967
exon
HITS-CLIP
DIRECT
LncBasev2
X:73825461-73825489
exon
HITS-CLIP
DIRECT
LncBasev2
X:73850840-73850868
exon
HITS-CLIP
DIRECT
LncBasev2
X:73842006-73842034
exon
HITS-CLIP
DIRECT
LncBasev2
X:73851939-73851967
exon
HITS-CLIP
DIRECT
LncBasev2
X:73841602-73841630
exon
HITS-CLIP
DIRECT
LncBasev2
X:73852169-73852197
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_000914
hsa-miR-3145-3p
IP

Gene Details
Chromosome: chr1
Transcript: TCONS_00001578
Biotype: transcript isomorph
Gene id: XLOC_000914
Gene Name: XLOC_000914
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
- Testes Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
chr1:90513202-90513230
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_013174
hsa-miR-3145-3p
IP

Gene Details
Chromosome: chr19
Transcript: TCONS_00027635
Biotype: transcript isomorph
Gene id: XLOC_013174
Gene Name: XLOC_013174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3145-3p
Sequence: agauauuuugaguguuuggaauug
MirBase ID: MIMAT0015016
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
chr19:57297991-57298019
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: