Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3157-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC009133.15
hsa-miR-3157-3p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566537
Biotype: antisense
Gene id: ENSG00000259952
Gene Name: AC009133.15
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:29807497-29807525
exon
HITS-CLIP
DIRECT
LncBasev2
AC074363.1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000442316
Biotype: lincRNA
Gene id: ENSG00000228222
Gene Name: AC074363.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:167293213-167293241
exon
HITS-CLIP
DIRECT
LncBasev2
AC091633.2
hsa-miR-3157-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000454858
Biotype: processed_pseudogene
Gene id: ENSG00000236844
Gene Name: AC091633.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:195554770-195554798
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:28992645-28992673
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
22:28788424-28788452
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-250P20.2
hsa-miR-3157-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000506083
Biotype: processed_pseudogene
Gene id: ENSG00000251467
Gene Name: CTC-250P20.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
5:72997382-72997410
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
19:48481017-48481045
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479877-48479905
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479877-48479905
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606319
Biotype: antisense
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:476037-476065
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:479208-479236
exon
HITS-CLIP
DIRECT
LncBasev2
5:480265-480293
exon
HITS-CLIP
DIRECT
LncBasev2
5:480477-480505
exon
HITS-CLIP
DIRECT
LncBasev2
5:479208-479236
exon
HITS-CLIP
DIRECT
LncBasev2
5:478489-478517
exon
HITS-CLIP
DIRECT
LncBasev2
5:480518-480546
exon
HITS-CLIP
DIRECT
LncBasev2
5:480518-480546
exon
HITS-CLIP
DIRECT
LncBasev2
5:479245-479273
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2517M22.17
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000580385
Biotype: antisense
Gene id: ENSG00000265393
Gene Name: CTD-2517M22.17
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
8:144512641-144512683
exon
HITS-CLIP
DIRECT
LncBasev2
DIO3OS
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000556120
Biotype: lincRNA
Gene id: ENSG00000258498
Gene Name: DIO3OS
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
14:101552470-101552498
exon
HITS-CLIP
DIRECT
LncBasev2
DIO3OS
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 14
Transcript: NR_002770.1
Biotype: lincRNA
Gene id: NR_002770.1 (gene)
Gene Name: DIO3OS
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
14:101552470-101552498
exon
HITS-CLIP
DIRECT
LncBasev2
EI24P1
hsa-miR-3157-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000416584
Biotype: processed_pseudogene
Gene id: ENSG00000236357
Gene Name: EI24P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
3:176068891-176068919
exon
HITS-CLIP
DIRECT
LncBasev2
FGD5-AS1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000424349
Biotype: antisense
Gene id: ENSG00000225733
Gene Name: FGD5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
3:14943284-14943312
exon
HITS-CLIP
DIRECT
LncBasev2
GATA2-AS1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 3
Transcript: ENST00000464242
Biotype: antisense
Gene id: ENSG00000244300
Gene Name: GATA2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:128497067-128497095
exon
HITS-CLIP
DIRECT
LncBasev2
GNAS-AS1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000443966
Biotype: antisense
Gene id: ENSG00000235590
Gene Name: GNAS-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
20:58840276-58840304
exon
HITS-CLIP
DIRECT
LncBasev2
GS1-358P8.4
hsa-miR-3157-3p
IP

Gene Details
Chromosome: X
Transcript: ENST00000568479
Biotype: sense_overlapping
Gene id: ENSG00000260822
Gene Name: GS1-358P8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:24546835-24546863
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P11
hsa-miR-3157-3p
-
IP

Gene Details
Chromosome: 18
Transcript: ENST00000580106
Biotype: processed_pseudogene
Gene id: ENSG00000264315
Gene Name: HNRNPA1P11
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
18:72619179-72619207
exon
HITS-CLIP
DIRECT
LncBasev2
HPN-AS1
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 19
Transcript: NR_024561.1
Biotype: lincRNA
Gene id: NR_024561.1 (gene)
Gene Name: HPN-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:35074015-35074043
exon
HITS-CLIP
DIRECT
LncBasev2
HTT-AS
hsa-miR-3157-3p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000503893
Biotype: antisense
Gene id: ENSG00000251075
Gene Name: HTT-AS
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-3p
Sequence: cugcccuagucuagcugaagcu
MirBase ID: MIMAT0019210
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
4:3070015-3070043
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: