Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3157-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004951.6
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000447643
Biotype: lincRNA
Gene id: ENSG00000228434
Gene Name: AC004951.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:44005169-44005197
exon
HITS-CLIP
DIRECT
LncBasev2
AC013470.8
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000453438
Biotype: processed_pseudogene
Gene id: ENSG00000224667
Gene Name: AC013470.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:12506931-12506959
exon
HITS-CLIP
DIRECT
LncBasev2
AC092667.2
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434301
Biotype: antisense
Gene id: ENSG00000230393
Gene Name: AC092667.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:100106635-100106663
exon
HITS-CLIP
DIRECT
LncBasev2
AC093802.1
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000407524
Biotype: lincRNA
Gene id: ENSG00000220256
Gene Name: AC093802.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:239801782-239801810
exon
HITS-CLIP
DIRECT
LncBasev2
AKAP17BP
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000431706
Biotype: unprocessed_pseudogene
Gene id: ENSG00000214992
Gene Name: AKAP17BP
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
X:119257504-119257532
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32A-IT1
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_026808.1
Biotype: sense
Gene id: NR_026808.1 (gene)
Gene Name: ANP32A-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
15:68806009-68806037
exon
HITS-CLIP
DIRECT
LncBasev2
ANP32BP2
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000454525
Biotype: processed_pseudogene
Gene id: ENSG00000231801
Gene Name: ANP32BP2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:44651841-44651869
exon
HITS-CLIP
DIRECT
LncBasev2
AP000233.2
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000418942
Biotype: lincRNA
Gene id: ENSG00000232512
Gene Name: AP000233.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
21:25101169-25101197
exon
HITS-CLIP
DIRECT
LncBasev2
AP000320.6
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000440403
Biotype: antisense
Gene id: ENSG00000225555
Gene Name: AP000320.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
21:34375302-34375330
exon
HITS-CLIP
DIRECT
LncBasev2
AP000320.7
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: 21
Transcript: ENST00000362077
Biotype: processed_transcript
Gene id: ENSG00000272657
Gene Name: AP000320.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
21:34125399-34125427
exon
HITS-CLIP
DIRECT
LncBasev2
21:34125399-34125427
exon
HITS-CLIP
DIRECT
LncBasev2
ATP6V0E2-AS1
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000461019
Biotype: antisense
Gene id: ENSG00000204934
Gene Name: ATP6V0E2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:149867990-149868018
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207814612-207814640
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140528151-140528179
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:28975902-28975930
exon
HITS-CLIP
DIRECT
LncBasev2
CLUHP3
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000562354
Biotype: processed_transcript
Gene id: ENSG00000131797
Gene Name: CLUHP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:31710486-31710514
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-228A9.4
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000624072
Biotype: antisense
Gene id: ENSG00000279080
Gene Name: CTA-228A9.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
22:38144683-38144711
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-265F19.1
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587894
Biotype: sense_intronic
Gene id: ENSG00000267749
Gene Name: CTC-265F19.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:2642480-2642508
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-459F4.3
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
19:27795824-27795852
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3157-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606074
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:477987-478015
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3157-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3157-5p
Sequence: uucagccaggcuagugcagucu
MirBase ID: MIMAT0015031
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
5:479223-479251
exon
HITS-CLIP
DIRECT
LncBasev2
5:479223-479251
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: