Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-320a

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000120.7
hsa-miR-320a
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92205797-92205825
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-320a
IP

Gene Details
Chromosome: 7
Transcript: ENST00000584023
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30574515-30574543
exon
HITS-CLIP
DIRECT
LncBasev2
AC007163.3
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000452787
Biotype: lincRNA
Gene id: ENSG00000237166
Gene Name: AC007163.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:200712736-200712764
exon
HITS-CLIP
DIRECT
LncBasev2
AC009120.6
hsa-miR-320a
IP

Gene Details
Chromosome: 16
Transcript: ENST00000621548
Biotype: lincRNA
Gene id: ENSG00000259972
Gene Name: AC009120.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
16:74305832-74305860
exon
HITS-CLIP
DIRECT
LncBasev2
AC009299.2
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000421122
Biotype: antisense
Gene id: ENSG00000235724
Gene Name: AC009299.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:161254572-161254600
exon
HITS-CLIP
DIRECT
LncBasev2
AC012501.3
hsa-miR-320a
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000437634
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000242575
Gene Name: AC012501.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:153421551-153421579
exon
PAR-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-320a
IP

Gene Details
Chromosome: 15
Transcript: ENST00000557682
Biotype: lincRNA
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92898472-92898500
exon
HITS-CLIP
DIRECT
LncBasev2
15:92898788-92898816
exon
HITS-CLIP
DIRECT
LncBasev2
15:92898756-92898784
exon
HITS-CLIP
DIRECT
LncBasev2
AC017116.11
hsa-miR-320a
IP

Gene Details
Chromosome: 7
Transcript: ENST00000445938
Biotype: sense_overlapping
Gene id: ENSG00000239775
Gene Name: AC017116.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:44066023-44066051
exon
HITS-CLIP
DIRECT
LncBasev2
AC074286.1
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000397057
Biotype: sense_overlapping
Gene id: ENSG00000213963
Gene Name: AC074286.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:177287614-177287642
exon
HITS-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-320a
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20259053-20259081
exon
HITS-CLIP
DIRECT
LncBasev2
AC093323.3
hsa-miR-320a
IP

Gene Details
Chromosome: 4
Transcript: ENST00000307533
Biotype: lincRNA
Gene id: ENSG00000170846
Gene Name: AC093323.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:6675187-6675215
exon
HITS-CLIP
DIRECT
LncBasev2
AC097468.7
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000429343
Biotype: antisense
Gene id: ENSG00000235024
Gene Name: AC097468.7
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:218944882-218944910
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.9
hsa-miR-320a
IP

Gene Details
Chromosome: 8
Transcript: ENST00000602575
Biotype: sense_intronic
Gene id: ENSG00000269918
Gene Name: AF131215.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11106060-11106088
exon
HITS-CLIP
DIRECT
LncBasev2
AF131216.5
hsa-miR-320a
IP

Gene Details
Chromosome: 8
Transcript: ENST00000525867
Biotype: antisense
Gene id: ENSG00000255020
Gene Name: AF131216.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11346127-11346155
exon
HITS-CLIP
DIRECT
LncBasev2
ALMS1-IT1
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000441587
Biotype: sense_intronic
Gene id: ENSG00000230002
Gene Name: ALMS1-IT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:73458964-73458992
exon
HITS-CLIP
DIRECT
LncBasev2
ALMS1-IT1
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: NR_046762.1
Biotype: sense
Gene id: NR_046762.1 (gene)
Gene Name: ALMS1-IT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:73458964-73458992
exon
HITS-CLIP
DIRECT
LncBasev2
BOLA3-AS1
hsa-miR-320a
IP

Gene Details
Chromosome: 2
Transcript: ENST00000423477
Biotype: antisense
Gene id: ENSG00000225439
Gene Name: BOLA3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:74148905-74148933
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-320a
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646060-116646088
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf23
hsa-miR-320a
IP

Gene Details
Chromosome: 14
Transcript: ENST00000399387
Biotype: lincRNA
Gene id: ENSG00000186960
Gene Name: C14orf23
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:28792853-28792881
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-320a
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-320a
Sequence: aaaagcuggguugagagggcga
MirBase ID: MIMAT0000510
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207802792-207802820
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207815282-207815310
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: