Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-338-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004540.5
hsa-miR-338-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000421862
Biotype: lincRNA
Gene id: ENSG00000214870
Gene Name: AC004540.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:26440394-26440422
exon
HITS-CLIP
DIRECT
LncBasev2
AC005562.1
hsa-miR-338-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000440026
Biotype: processed_transcript
Gene id: ENSG00000214719
Gene Name: AC005562.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:30608477-30608505
exon
HITS-CLIP
DIRECT
LncBasev2
AC006116.17
hsa-miR-338-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587620
Biotype: antisense
Gene id: ENSG00000267549
Gene Name: AC006116.17
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:56315400-56315428
exon
HITS-CLIP
DIRECT
LncBasev2
AC006227.1
hsa-miR-338-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000455614
Biotype: lincRNA
Gene id: ENSG00000229457
Gene Name: AC006227.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Thyroid Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
2:107282719-107282747
exon
HITS-CLIP
DIRECT
LncBasev2
AC007228.8
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600036
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000268036
Gene Name: AC007228.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:56613884-56613912
exon
HITS-CLIP
DIRECT
LncBasev2
AC007318.5
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000467568
Biotype: processed_pseudogene
Gene id: ENSG00000172974
Gene Name: AC007318.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:65205923-65205951
exon
HITS-CLIP
DIRECT
LncBasev2
AC009228.1
hsa-miR-338-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000430105
Biotype: antisense
Gene id: ENSG00000242628
Gene Name: AC009228.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:24221444-24221472
exon
HITS-CLIP
DIRECT
LncBasev2
AC012309.5
hsa-miR-338-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37263198-37263226
exon
HITS-CLIP
DIRECT
LncBasev2
AC012531.25
hsa-miR-338-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562848
Biotype: lincRNA
Gene id: ENSG00000260597
Gene Name: AC012531.25
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
12:54021532-54021560
exon
HITS-CLIP
DIRECT
LncBasev2
AC013394.2
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000554133
Biotype: retained_intron
Gene id: ENSG00000272888
Gene Name: AC013394.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:92884391-92884419
exon
HITS-CLIP
DIRECT
LncBasev2
AC018647.3
hsa-miR-338-3p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000458087
Biotype: lincRNA
Gene id: ENSG00000227544
Gene Name: AC018647.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:35716977-35717005
exon
HITS-CLIP
DIRECT
LncBasev2
AC027612.6
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000609777
Biotype: processed_transcript
Gene id: ENSG00000143429
Gene Name: AC027612.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:91617984-91618012
exon
HITS-CLIP
DIRECT
LncBasev2
AC113189.5
hsa-miR-338-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000415124
Biotype: antisense
Gene id: ENSG00000233223
Gene Name: AC113189.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:7582025-7582053
exon
HITS-CLIP
DIRECT
LncBasev2
AC125238.2
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000430003
Biotype: processed_pseudogene
Gene id: ENSG00000233459
Gene Name: AC125238.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:203635976-203636004
exon
HITS-CLIP
DIRECT
LncBasev2
ACTR3P2
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000439585
Biotype: processed_pseudogene
Gene id: ENSG00000232267
Gene Name: ACTR3P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
X:68772450-68772478
exon
HITS-CLIP
DIRECT
LncBasev2
AL133243.2
hsa-miR-338-3p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000617415
Biotype: sense_intronic
Gene id: ENSG00000276517
Gene Name: AL133243.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:32527442-32527470
exon
HITS-CLIP
DIRECT
LncBasev2
AL133493.2
hsa-miR-338-3p
IP

Gene Details
Chromosome: 21
Transcript: ENST00000424569
Biotype: lincRNA
Gene id: ENSG00000233922
Gene Name: AL133493.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
- Ovary Normal/Primary
- Testes Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
21:45595589-45595617
exon
HITS-CLIP
DIRECT
LncBasev2
ANXA2P2
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000435128
Biotype: processed_pseudogene
Gene id: ENSG00000231991
Gene Name: ANXA2P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:33624970-33624998
exon
HITS-CLIP
DIRECT
LncBasev2
AP000347.2
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000417194
Biotype: processed_transcript
Gene id: ENSG00000272578
Gene Name: AP000347.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:23692814-23692848
exon
HITS-CLIP
DIRECT
LncBasev2
AP000436.4
hsa-miR-338-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000605239
Biotype: processed_pseudogene
Gene id: ENSG00000270775
Gene Name: AP000436.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-3p
Sequence: uccagcaucagugauuuuguug
MirBase ID: MIMAT0000763
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65026228-65026256
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: