Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-338-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC005082.12
hsa-miR-338-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000413042
Biotype: lincRNA
Gene id: ENSG00000226816
Gene Name: AC005082.12
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
7:23206984-23207012
exon
HITS-CLIP
DIRECT
LncBasev2
AC005498.3
hsa-miR-338-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593218
Biotype: lincRNA
Gene id: ENSG00000267421
Gene Name: AC005498.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:56538203-56538231
exon
HITS-CLIP
DIRECT
LncBasev2
AC006548.28
hsa-miR-338-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:16993760-16993788
exon
HITS-CLIP
DIRECT
LncBasev2
AC092155.1
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000454675
Biotype: processed_pseudogene
Gene id: ENSG00000229503
Gene Name: AC092155.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:62532836-62532864
exon
HITS-CLIP
DIRECT
LncBasev2
2:62532941-62532969
exon
HITS-CLIP
DIRECT
LncBasev2
AF131215.9
hsa-miR-338-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000602575
Biotype: sense_intronic
Gene id: ENSG00000269918
Gene Name: AF131215.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:11106091-11106119
exon
HITS-CLIP
DIRECT
LncBasev2
AGPAT5P1
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000455855
Biotype: processed_pseudogene
Gene id: ENSG00000234652
Gene Name: AGPAT5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
Y:3294067-3294095
exon
HITS-CLIP
DIRECT
LncBasev2
AKIRIN1P2
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000440655
Biotype: processed_pseudogene
Gene id: ENSG00000228125
Gene Name: AKIRIN1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
X:68133122-68133150
exon
HITS-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271143-41271171
exon
HITS-CLIP
DIRECT
LncBasev2
API5P1
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000424316
Biotype: processed_pseudogene
Gene id: ENSG00000234558
Gene Name: API5P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:116107990-116108018
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-338-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140522192-140522220
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-338-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149495318-149495346
exon
HITS-CLIP
DIRECT
LncBasev2
5:149495529-149495557
exon
HITS-CLIP
DIRECT
LncBasev2
5:149494911-149494939
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494911-149494939
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-338-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57308214-57308266
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2292M16.8
hsa-miR-338-5p
IP

Gene Details
Chromosome: 14
Transcript: ENST00000556738
Biotype: lincRNA
Gene id: ENSG00000258768
Gene Name: CTD-2292M16.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:20263374-20263402
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2527I21.9
hsa-miR-338-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601692
Biotype: sense_intronic
Gene id: ENSG00000267874
Gene Name: CTD-2527I21.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:35036348-35036376
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P10
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000475365
Biotype: processed_pseudogene
Gene id: ENSG00000243746
Gene Name: EEF1A1P10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
7:144648227-144648255
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P11
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415278
Biotype: processed_pseudogene
Gene id: ENSG00000228502
Gene Name: EEF1A1P11
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:96447414-96447442
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P12
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000443590
Biotype: processed_pseudogene
Gene id: ENSG00000214199
Gene Name: EEF1A1P12
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:106697505-106697542
exon
HITS-CLIP
DIRECT
LncBasev2
2:106698329-106698357
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P13
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000503537
Biotype: processed_pseudogene
Gene id: ENSG00000250182
Gene Name: EEF1A1P13
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652979-14653007
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:14652979-14653007
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P14
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421195
Biotype: processed_pseudogene
Gene id: ENSG00000233057
Gene Name: EEF1A1P14
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:194189286-194189314
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1A1P19
hsa-miR-338-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000513637
Biotype: processed_pseudogene
Gene id: ENSG00000249855
Gene Name: EEF1A1P19
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-338-5p
Sequence: aacaauauccuggugcugagug
MirBase ID: MIMAT0004701
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:43495946-43495974
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: