Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-34a-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
ABHD14A-ACY1
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 3
Transcript: NR_037192.1
Biotype: sense
Gene id: NR_037192.1 (gene)
Gene Name: ABHD14A-ACY1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:51988775-51988803
exon
HITS-CLIP
DIRECT
LncBasev2
AC004540.5
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000439120
Biotype: lincRNA
Gene id: ENSG00000214870
Gene Name: AC004540.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:26494215-26494243
exon
HITS-CLIP
DIRECT
LncBasev2
AC004951.6
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000447643
Biotype: lincRNA
Gene id: ENSG00000228434
Gene Name: AC004951.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:44004087-44004115
exon
HITS-CLIP
DIRECT
LncBasev2
AC005042.2
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000393397
Biotype: processed_pseudogene
Gene id: ENSG00000227331
Gene Name: AC005042.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:158548768-158548796
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000454922
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30577770-30577798
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000584108
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30573458-30573486
exon
HITS-CLIP
DIRECT
LncBasev2
AC005754.8
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000606030
Biotype: lincRNA
Gene id: ENSG00000272108
Gene Name: AC005754.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:141120285-141120313
exon
HITS-CLIP
DIRECT
LncBasev2
AC006041.1
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000425322
Biotype: lincRNA
Gene id: ENSG00000229379
Gene Name: AC006041.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:15841300-15841328
exon
HITS-CLIP
DIRECT
LncBasev2
AC007036.5
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000511893
Biotype: sense_overlapping
Gene id: ENSG00000251660
Gene Name: AC007036.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159237-30159265
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30159237-30159265
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39600338-39600366
exon
HITS-CLIP
DIRECT
LncBasev2
AC007386.2
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449259
Biotype: lincRNA
Gene id: ENSG00000237638
Gene Name: AC007386.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:64904393-64904421
exon
PAR-CLIP
DIRECT
LncBasev2
AC025335.1
hsa-miR-34a-5p
Bi

Gene Details
Chromosome: 17
Transcript: ENST00000324348
Biotype: antisense
Gene id: ENSG00000179859
Gene Name: AC025335.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
K562
Bi
Tested Cell Line: K562
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
-
Biotin-Microarrays
INDIRECT
LncBasev2
AC058791.1
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_034120.1
Biotype: lincRNA
Gene id: NR_034120.1 (gene)
Gene Name: AC058791.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:130913005-130913033
exon
HITS-CLIP
DIRECT
LncBasev2
AC069154.4
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432914
Biotype: processed_pseudogene
Gene id: ENSG00000229326
Gene Name: AC069154.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:119700008-119700036
exon
PAR-CLIP
DIRECT
LncBasev2
AC078899.1
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000521432
Biotype: processed_pseudogene
Gene id: ENSG00000213985
Gene Name: AC078899.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258946-20258974
exon
HITS-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:20258946-20258974
exon
HITS-CLIP
DIRECT
LncBasev2
AC092535.3
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 4
Transcript: ENST00000417557
Biotype: antisense
Gene id: ENSG00000227189
Gene Name: AC092535.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
4:1153493-1153521
exon
HITS-CLIP
DIRECT
LncBasev2
AC105342.1
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000378334
Biotype: processed_pseudogene
Gene id: ENSG00000234429
Gene Name: AC105342.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:81197343-81197371
exon
HITS-CLIP
DIRECT
LncBasev2
AC114271.2
hsa-miR-34a-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000612689
Biotype: antisense
Gene id: ENSG00000274425
Gene Name: AC114271.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:10334001-10334029
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP6
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000520036
Biotype: processed_pseudogene
Gene id: ENSG00000203413
Gene Name: ACTBP6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:84949487-84949515
exon
HITS-CLIP
DIRECT
LncBasev2
ACTG1P2
hsa-miR-34a-5p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000415776
Biotype: processed_pseudogene
Gene id: ENSG00000229129
Gene Name: ACTG1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:17757171-17757199
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: