Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-3615

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC000120.7
hsa-miR-3615
IP

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200218-92200246
exon
PAR-CLIP
DIRECT
LncBasev2
7:92200218-92200246
exon
PAR-CLIP
DIRECT
LncBasev2
Bone Marrow
BCBL1
IP
Tested Cell Line: BCBL1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:92200218-92200246
exon
HITS-CLIP
DIRECT
LncBasev2
AC004386.4
hsa-miR-3615
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000393214
Biotype: processed_pseudogene
Gene id: ENSG00000213269
Gene Name: AC004386.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
X:74376227-74376255
exon
HITS-CLIP
DIRECT
LncBasev2
AC005363.9
hsa-miR-3615
-
IP

Gene Details
Chromosome: 16
Transcript: ENST00000530779
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000255513
Gene Name: AC005363.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
16:1963984-1964012
exon
HITS-CLIP
DIRECT
LncBasev2
AC007283.5
hsa-miR-3615
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434645
Biotype: lincRNA
Gene id: ENSG00000234431
Gene Name: AC007283.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:201167406-201167434
exon
HITS-CLIP
DIRECT
LncBasev2
AC027612.1
hsa-miR-3615
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000413684
Biotype: processed_pseudogene
Gene id: ENSG00000232531
Gene Name: AC027612.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
2:91748131-91748159
exon
HITS-CLIP
DIRECT
LncBasev2
ADIPOQ-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: 3
Transcript: ENST00000422718
Biotype: antisense
Gene id: ENSG00000226482
Gene Name: ADIPOQ-AS1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
3:186852447-186852475
exon
HITS-CLIP
DIRECT
LncBasev2
ASMTL-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: X
Transcript: ENST00000425740
Biotype: antisense
Gene id: ENSG00000236017
Gene Name: ASMTL-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
X:1402022-1402050
exon
HITS-CLIP
DIRECT
LncBasev2
C1orf132
hsa-miR-3615
IP

Gene Details
Chromosome: 1
Transcript: ENST00000608023
Biotype: lincRNA
Gene id: ENSG00000203709
Gene Name: C1orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:207810056-207810084
exon
HITS-CLIP
DIRECT
LncBasev2
1:207810056-207810084
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:207814701-207814729
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-3615
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140521144-140521172
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:140525186-140525214
exon
HITS-CLIP
DIRECT
LncBasev2
CCDC183-AS1
hsa-miR-3615
IP

Gene Details
Chromosome: 9
Transcript: ENST00000414656
Biotype: antisense
Gene id: ENSG00000228544
Gene Name: CCDC183-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
9:136806055-136806085
exon
HITS-CLIP
DIRECT
LncBasev2
9:136806055-136806085
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-3615
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:29054963-29054993
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-204B4.2
hsa-miR-3615
IP

Gene Details
Chromosome: 8
Transcript: ENST00000564464
Biotype: antisense
Gene id: ENSG00000259891
Gene Name: CTA-204B4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:hippuristanol
Location
Region
Method
Result
Validation Type
Source
8:140508036-140508066
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.1
hsa-miR-3615
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000509301
Biotype: processed_pseudogene
Gene id: ENSG00000250645
Gene Name: CTD-2228K2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
5:418735-418767
exon
HITS-CLIP
DIRECT
LncBasev2
5:418735-418767
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2228K2.7
hsa-miR-3615
IP

Gene Details
Chromosome: 5
Transcript: ENST00000534918
Biotype: retained_intron
Gene id: ENSG00000225138
Gene Name: CTD-2228K2.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
5:479339-479367
exon
HITS-CLIP
DIRECT
LncBasev2
5:478447-478475
exon
HITS-CLIP
DIRECT
LncBasev2
5:478539-478567
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2303H24.2
hsa-miR-3615
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425211
Biotype: processed_transcript
Gene id: ENSG00000273018
Gene Name: CTD-2303H24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
17:18512318-18512346
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2349P21.1
hsa-miR-3615
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000490847
Biotype: processed_pseudogene
Gene id: ENSG00000242439
Gene Name: CTD-2349P21.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:30831126-30831154
exon
HITS-CLIP
DIRECT
LncBasev2
17:30831126-30831154
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2537I9.13
hsa-miR-3615
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592252
Biotype: sense_intronic
Gene id: ENSG00000267096
Gene Name: CTD-2537I9.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:55671761-55671789
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2561J22.2
hsa-miR-3615
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000594254
Biotype: unprocessed_pseudogene
Gene id: ENSG00000213976
Gene Name: CTD-2561J22.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:21386466-21386494
exon
PAR-CLIP
DIRECT
LncBasev2
CTD-2587H24.14
hsa-miR-3615
IP

Gene Details
Chromosome: 19
Transcript: ENST00000586923
Biotype: retained_intron
Gene id: ENSG00000276570
Gene Name: CTD-2587H24.14
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:55230270-55230302
exon
HITS-CLIP
DIRECT
LncBasev2
19:55230270-55230300
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2622I13.3
hsa-miR-3615
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600056
Biotype: sense_intronic
Gene id: ENSG00000268670
Gene Name: CTD-2622I13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor

miRNA Details
Name: hsa-miR-3615
Sequence: ucucucggcuccucgcggcuc
MirBase ID: MIMAT0017994
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:4062017-4062047
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: